Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Nakashima, H.
Right arrow Articles by Niho, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakashima, H.
Right arrow Articles by Niho, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Rheumatology 1999; 38: 1142-1144
© 1999 British Society for Rheumatology

Polymorphisms within the interleukin-10 receptor cDNA gene (IL10R) in Japanese patients with systemic lupus erythematosus

H. Nakashima, M. Akahoshi, Y. Tanaka, K. Yamaoka, E. Ogami, S. Nagano, Y. Arinobu, H. Niiro, T. Otsuka and Y. Niho

First Department of Internal Medicine, Faculty of Medicine, Kyushu University, Fukuoka, Japan

Correspondence to: H. Nakashima, First Department of Internal Medicine, Faculty of Medicine, Kyushu University, Fukuoka, 812-8582, Japan.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Objective. To assess the association between polymorphisms within the interleukin-10 receptor cDNA gene (IL10R) and systemic erythematosus (SLE) in Japanese people.

Method. We examined the IL-10 receptor genotype of 109 SLE patients and 102 healthy subjects by the reverse transcription-polymerase chain reaction-restriction fragment length polymorphism (RT-PCR-RFLP) method.

Results. There was no difference in the IL10R genotype frequencies of these two groups.

Conclusion. The IL10R genotype does not determine susceptibility to SLE in Japanese people.

KEY WORDS: IL-10, IL-10 receptor gene (IL10R), Polymorphism, Susceptibility, Systemic lupus erythematosus


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Systemic lupus erythematosus (SLE) is characterized by multisystem inflammation and the production of autoantibodies. Genetic factors seem to play a significant role in susceptibility to SLE. Although there have been a number of reports concerning the role of allelism within the major histocompatibility complex (MHC) with regard to susceptibility to SLE, the involvement of other genes outside the MHC is not clear. The association of SLE with autoimmunity and inflammation suggests the importance of genes involved in the cytokine network [13].

Interleukin-10 (IL-10) was originally defined as a cytokine which alters the balance of murine Th1/Th2 activity [4] in favour of a Th2 type response. IL-10 diminishes macrophage function and antigen presentation, thereby inhibiting T-cell activation [57]. Raised IL-10 levels have been reported in several autoimmune states [8], and Llorente et al. [9] have suggested that hypergammaglobulinaemia in SLE is IL-10 dependent. Increased IL-10 production, therefore, may contribute to SLE through B-cell autoantibody production. In fact, removing IL-10 with anti-IL-10 antibodies slows the development of murine autoimmunity [10].

Studies of polymorphism within the IL-10 gene have been carried out by several groups [1113]. One of two microsatellite loci has shown an altered distribution of allele frequencies in patients with lupus compared to controls, with evidence of an association between microsatellite alleles and the class of autoantibody [14]. In this brief report, we studied 102 Japanese SLE patients in order to clarify the contribution of the polymorphism within the cDNA gene for the IL-10 receptor, through which the activity of IL-10 is mediated, to SLE using reverse transcription-polymerase chain reaction-restriction fragment length polymorphism (RT-PCR-RFLP).


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Patients and healthy controls
This study included 109 clinic out-patients with SLE (12 males and 97 females, mean age 40.5 yr, S.D. 12.54, range 16–78 yr) and 102 healthy volunteers (13 males and 89 females, mean age 40.2 yr, S.D. 12.98, range 17–76 yr). All the patients had met more than four of the American Rheumatism Association revised criteria for the diagnosis of SLE.

Detection of polymorphism and genotyping for the IL-10R cDNA
We previously reported two DNA polymorphisms within the IL10R cDNA gene, which were detectable by the RT-PCR-RFLP method [15]. Briefly, total RNA was extracted from peripheral mononuclear cells (2x107 cells) of individuals by the guanidinium isothiocyanate/phenol extraction method (Isogen, Nippon Gene Ltd, Tokyo, Japan). One-tenth of the total RNA preparation was used in a first-strand cDNA synthesis (RNA PCR Kit, PE Biosystems Japan Ltd, Urayasu, Japan). One-fifth of the cDNA reaction mixture was used as a template in the PCR. The reaction was performed according to the manufacturer's recommendations. Briefly, the RT reaction was carried out at 42°C for 15 min and cycling conditions for PCR were an initial 2 min at 94°C, followed by 1 min at 94°C and 1 min at 60°C for 35 cycles with an extension time of 7 min at 72°C. The G241A polymorphism was documented by HhaI digestion. RT-PCR amplification of total RNA with YF10R-I primers produced a 289 bp fragment. HhaI digestion of this fragment resulted in two alleles. When digested, the G241 allele (A1), which contains the intact HhaI recognition site, produced two fragments of 103 and 186 bp (Fig. 1AGo).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 1.  (A) RT-PCR-RFLP analysis for G241A polymorphism. The amplified products from RNAs using YF10R-I primers (upper: 5'GCCCAGCCCTCCGTCTGTGTGGTTT3'; lower: 5'TTCATCCACAGAGAAGCGGG3') were digested with the endonuclease HhaI and electrophoresed on 4% agarose gel. Ethidium bromide-stained DNAs show RFLP. Lane C is the digest control, which was the restriction fragment pattern of the PCR product templated with a plasmid clone containing the G241 allele. (B) RT-PCR-RFLP analysis for G520A polymorphism. The amplified products from RNAs using YF10R-II primers (upper: 5'CACCAACACCCGCTTCTCTGT3'; lower: 5'GTGAAATACTGCCTGGTGAG3') were digested with the endonuclease AccII and electrophoresed on 4% agarose gel. Ethidium bromide-stained DNAs show RFLP. Lane C is the digest control, which was the restriction fragment pattern of the PCR product templated with a plasmid clone containing the G520 allele.

 
The other polymorphism, G520A, was detected by AccII digestion of the RT-PCR product with YF10R-II primers. The G520 allele (B1), which contains the intact AccII site, shows 119 and 238 bp fragments. The A520 allele (B2) fragment, which lacks the AccII site, was 357 bp (Fig. 1BGo).

Genotyping for the individuals who were heterogeneous for both polymorphic sites was carried out as follows. RT-PCR products which were generated with the YF10R-I upper and YF10R-II lower primers were double digested with 5 U of HhaI and AccII, and size separated by 4% agarose gel electrophoresis. The A1B1, A1B2, A2B2 and A2B1 alleles should have 98, 277 and 238 bp fragments, 98 and 515 bp fragments, 613 bp fragments, and 375 and 238 bp fragments, respectively.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The frequencies of IL10R cDNA haplotypes and genotypes in patients with SLE and controls are shown in Table 1Go. No genotype was found to be significantly associated with SLE.


View this table:
[in this window]
[in a new window]
 
TABLE 1.  (A) Haplotype frequencies
 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We analysed the polymorphisms within IL10R cDNA in Japanese patients with SLE. We previously reported two DNA polymorphisms within the IL10R cDNA gene [15]. These polymorphisms probably do not alter receptor function because they do not lead to amino acid substitutions, and there is no possibility that these polymorphisms directly influence susceptibility to SLE. However, we were able to determine four haplotypes and 10 genotypes concerning this gene based on these polymorphisms. The existence of specific haplotype or genotype links to SLE means that the IL10R gene or a nearby gene would be one of a limited number of primary genetic defects that contribute to SLE.

We analysed the frequencies of these haplotypes and genotypes in SLE patients and healthy volunteers, and found that the frequencies in the patients were not significantly different from those in the healthy volunteers. Although it was reported that the presence of anti-Ro antibody in lupus was related to an allele in the promotor region of the IL10 gene [11], no particular genotype of IL-10R related to it (data not shown). These results suggest that the IL-10 receptor genotype does not determine susceptibility to SLE in Japanese people.

It was previously reported that serum IL-10 levels were significantly higher in SLE patients than in normal controls [16], and that they were clearly correlated with disease activity [17]. In view of the Th1/Th2 dichotomy, SLE is generally considered to be a disease which is polarized to Th2. In fact, we previously reported that a variant interferon-{gamma} (IFN-{gamma}) receptor 1 (IFGR1), which had a somewhat reduced receptor function compared with that of the normal receptor, was associated with SLE [18]. We hypothesized that Th0 cells bearing the variant IFGR1 may be apt to differentiate slightly towards Th2, and that the Th1/Th2 balance may be polarized to Th2. IL-10 is a Th2 cytokine, in contrast to IFN-{gamma}, and, accordingly, it may simply be a natural result that polymorphisms within IL10 are associated with susceptibility to SLE, while the IL-10 receptor gene, which induces receptor dysfunction, is not associated with such susceptibility.


    Acknowledgments
 
We thank Yuko Furukawa for her skilful technical assistance and Dr Motosuke Hanada for his encouragement and helpful advice.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 

  1.  Alarcon-Varela J, Alarcon-Segovia D. Decreased production of and response to IL-2 by cultured lymphocytes from patients with SLE. J Clin Invest 1982;69:1388–93.
  2.  Linker-Israeli M, Deans R, Wallace D, Prehn J, Ozeri-Chen T, Klinenberg J. Elevated levels of endogenous IL-6 in systemic lupus erythematosus. J Immunol 1991; 147:117–23.[Abstract]
  3.  Al-Janadi M, Al-Balla S, Al-Dalaan A, Raziuddin S. Cytokine profile in systemic lupus erythematosus, rheumatoid arthritis, and other rheumatic diseases. J Clin Immunol 1993;13:58–67.[Web of Science][Medline]
  4.  Fiorentino DF, Zlotnic A, Viera P et al. IL-10 acts on the antigen presenting cell to inhibit cytokine production by Th1 cells. J Immunol 1991;146:3444–51.[Abstract]
  5.  de Waal Malefyt R, Yssel H, de Vries JE. Direct effects of IL-10 on subsets of human CD4+ T cell clones and resting T cells. Specific inhibition of IL-2 production and proliferation. J Immunol 1993;150:4754–65.[Abstract]
  6.  Enk AH, Angeloni VT, Udey MC, Katz SI. Inhibition of Langerhans cell antigen-presenting function by IL-10: a role for IL-10 in induction of tolerance. J Immunol 1993;151:2390–8.[Abstract]
  7.  Howard M, O'Garra A. Biological properties of interleukin 10. Immunol Today 1992;6:198–200.
  8.  Llorente L, Richaud-Patin Y, Fior R et al. In vitro production of interleukin-10 by non-T cells in rheumatoid arthritis, Sjögren's syndrome, and systemic lupus erythematosus: a potential mechanism of B lymphocyte hyperactivity and autoimmunity. Arthritis Rheum 1994; 37:1647–55.[Web of Science][Medline]
  9.  Llorente L, Zou W, Levy Y et al. Role of interleukin 10 in the B cell lymphocyte hyperactivity and autoantibody production of human systemic lupus erythematosus. J Exp Med 1995;181:839–44.[Abstract/Free Full Text]
  10. Ishida H, Muchamuel T, Sakaguchi S, Andrade S, Menon S, Howard M. Continuous administration of anti-interleukin-10 antibodies delays the onset of autoimmunity in NZB/W F1 mice. J Exp Med 1994;179:305–10.[Abstract/Free Full Text]
  11. Lazarus M, Hajeer AH, Turner D et al. Genetic variation in the interleukin-10 gene promotor and systemic lupus erythematosus. J Rheumatol 1997;24:2314–7.[Web of Science][Medline]
  12. Eskdale J, Gallagher G. A polymorphic dinucleotide repeat in the human IL-10 promoter. Immunogenetics 1995;42:444–5.[Medline]
  13. Turner DM, Williams DM, Sankaran D, Lazarus M, Sinnott PJ, Hutchinson IV. An investigation of polymorphism in the interleukin-10 gene promotor. Eur J Immunogenet 1997;24:1–8.[Web of Science][Medline]
  14. Eskdale J, Wordsworth P, Bowman S, Field M, Gallagher G. Association between polymorphisms at the human IL-10 locus and systemic lupus erythematosus. Tissue Antigens 1997;49:653–9.[Medline]
  15. Tanaka Y, Nakashima H, Otsuka T et al. Detection of polymorphisms within human IL-10 receptor cDNA gene sequence by RT-PCR-RFLP. Immunogenetics 1997; 46:439–41.[Medline]
  16. Ishida H. Clinical implication of IL-10 in patients with immune and inflammatory disease. Jpn J Clin Pathol 1994;42:843–52.
  17. Park YB, Lee SK, Kim DS, Lee J, Lee CH, Song CH. Elevated interleukin-10 levels correlated with disease activity in systemic lupus erythematosus. Clin Exp Rheumatol 1998;16:283–8.[Web of Science][Medline]
  18. Tanaka Y, Nakashima H, Hisano C et al. Association of the interferon-{gamma} receptor variant (Val14Met) with Systemic Lupus Erythematosus. Immunogenetics 1999;49:266–71.[Medline]
Submitted 24 February 1999; revised version accepted 25 May 1999.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Pharmacol. Rev.Home page
K. Asadullah, W. Sterry, and H. D. Volk
Interleukin-10 Therapy--Review of a New Approach
Pharmacol. Rev., June 1, 2003; 55(2): 241 - 269.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Gasche, P. Grundtner, P. Zwirn, W. Reinisch, S. H. Shaw, A. Zdanov, U. Sarma, L. M. Williams, B. M. Foxwell, and A. Gangl
Novel Variants of the IL-10 Receptor 1 Affect Inhibition of Monocyte TNF-{alpha} Production
J. Immunol., June 1, 2003; 170(11): 5578 - 5582.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Nakashima, H.
Right arrow Articles by Niho, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nakashima, H.
Right arrow Articles by Niho, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?