Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Coakley, G.
Right arrow Articles by Lanchbury, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coakley, G.
Right arrow Articles by Lanchbury, J. S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Rheumatology 2000; 39: 393-398
© 2000 British Society for Rheumatology

Major histocompatility complex haplotypic associations in Felty's syndrome and large granular lymphocyte syndrome are secondary to allelic association with HLA-DRB1 *0401

G. Coakley, D. Brooks, M. Iqbal, E. Kondeatis1, R. Vaughan1, T. P. Loughran, Jr2, G. S. Panayi and J. S. Lanchbury

Departments of Rheumatology and
1 Tissue Typing, 5th Floor, Thomas Guy House, Guy's, King's and St Thomas' School of Medicine, Guy's Hospital, London SE1 9RT, UK and
2 H. Lee Moffitt Cancer Center, University of South Florida, 12902 Magnolia Drive, Suite 3157, Tampa, Florida, USA


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Objective. To investigate the role of HLA class I in susceptibility to Felty's syndrome (FS) and large granular lymphocyte (LGL) syndrome.

Methods. Fifty caucasoid FS patients, and 55 patients with LGL syndrome, of whom 26 had arthritis and 29 did not, were studied. Complete HLA class I and HLA-DR typing including, where relevant, DRB1*04 subtyping was carried out by molecular methods. Comparison was made with 78 unselected healthy caucasoid controls and a further 29 DRB1*0401+ individuals.

Results. A significant association was found between HLA-A*02 and FS [odds ratio (OR) 3.9, 95% confidence interval (95% CI) 1.8–8.4, P = 0.0004]. At the B locus, there was an association between B*44 and LGL with arthritis [OR 3.5 (1.3–9.2), P = 0.01]. For HLA-Cw*0501, there was an association with FS [OR 4 (1.7–9.2) P = 0.0008]. For both FS and LGL with arthritis, the extended haplotype HLA-A*02;B*44;Cw*0501;DRB1*0401 was significantly associated [OR 9.5 (2.6–35), P = 0.0001; OR 4.6 (1–22.4), P = 0.05, respectively]. There was no association between HLA class I or II and LGL without arthritis. All the allelic and haplotypic associations were lost on comparison with HLA-DRB1*0401+ controls. The strongest HLA association was with HLA-DRB1*0401 for FS [OR 27.9 (10.3–75.5), P = 10-13], and LGL with arthritis [OR 35.4 (9.6–131.3), P = 10-10].

Conclusions. The major histocompatibility locus (MHC) associations with FS reported here are due to linkage disequilibrium with HLA-DRB1*0401. LGL syndrome with arthritis shows identical class II associations with FS, although there may be subtle immunogenetic differences between the two in the class I region. One of the extended haplotypes reported in a number of studies for FS and rheumatoid arthritis (summarized as HLA-A*02;Cw*0501; B*44;TNFb5;TNFa6;TNFd4;C4A*3;C4BQ*0;DRB1*0401;DQB1*0301) is likely to be attributable to strong primary association with HLA-DRB1*0401, rather than to epistatic interaction between these loci.

KEY WORDS: Felty's syndrome, MHC, Genetics.


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Felty's syndrome (FS) is a rare complication of rheumatoid arthritis (RA) characterized by neutropenia and splenomegaly. Despite its rarity, it merits study both as a serious disease in its own right and as a model for investigating the genetic determinants of RA susceptibility. RA is a polygenic disease in which the environment plays an equal, if not dominant, role in disease development and expression. When performing studies to uncover the genetic component of a disease, it is advantageous if the patients studied are clinically as homogeneous as possible. Otherwise, disease heterogeneity will mask all but the strongest genetic effects.

In contrast to RA, FS is genetically homogeneous with respect to the best characterized genetic determinant, HLA-DR4. Over 90% of the patients are DR4+, compared with 60–70% of RA patients and approximately 30% of caucasoid controls [1,, 2]. In addition, there is an excess of DR4 homozygotes, particularly *0401/*0404 compound heterozygotes, giving a high relative risk for disease development [3]. Hence, whereas susceptibility to RA is strongly linked to the conserved HLA-DR beta epitope QRKRAA associated with several DRB1 alleles [1, 4], it is primarily the *0401 allele which is associated with progression to FS or severe RA. The high degree of clinical and immunogenetic homogeneity in FS makes it an ideal model to examine the role of genes other than HLA-DR in RA.

One important reason for studying HLA class I genes in FS is the high prevalence of CD8+ T cell expansions in the condition. Around 40% of FS patients have peripheral blood expansions of large granular lymphocytes (LGL) [5]. LGL fall into two subsets. CD3- CD8–CD56+ cells are natural killer cells, and patients with leukaemia of this subset follow an aggressive course. The expansion related to FS has the morphology CD8+CD57+, and these cells are more akin to cytotoxic T cells, in that they express CD3 and usually the {alpha} and ß chains of the T cell receptor. Some rare cases express the {gamma}{delta} T cell receptor. Moreover, normal CD8 T cells, when stimulated for 2 weeks in vitro, will acquire the CD57 marker [6].

LGL syndrome is a rare, low-grade malignancy characterized by neutropenia and splenomegaly. Around 30% of LGL patients have RA [7]. LGL syndrome with arthritis is closely related to FS and in both conditions, 90% of patients are positive for HLA-DRB1*04 [2]. LGL syndrome without arthritis shows no association with HLA-DRB1. This makes it a useful disease control, allowing easy assessment of whether any genetic association with LGL and arthritis is secondary to linkage disequilibrium with HLA-DRB1*04.

HLA-DRB1*04 is clearly a strong genetic factor leading to the development of FS. We sought to determine the role of another subregion within the major histocompatibility complex (MHC), HLA class I, in disease susceptibility. Furthermore, we aimed to identify extended MHC haplotypes for FS. Since LGLs are CD8+ T cells often expanded in the context of infections with cytomegalovirus [8] and human immunodeficiency virus [9], we hypothesized that there could be a class I association underlying the expansions seen in these conditions. Finally, since animal models exist in which there is evidence for one HLA molecule (e.g. HLA-DR) being presented by another (e.g. HLA-DQ) resulting in arthritis [10], we sought to explore the relationships between HLA class I and II in these incompletely understood diseases.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Fifty patients with FS were studied. Forty-four of these have been described previously [5], and six new cases were recruited. All fulfilled the American College of Rheumatology (ACR) criteria for RA [11], and in addition had a history of unexplained neutropenia (<2 x 109/l) for at least 6 months. Splenomegaly was not an essential criterion.

LGL syndrome was defined as the presence of >1 x 109/l LGL in the peripheral blood, persistent for at least 6 months. LGLs were defined either by morphology or by immunophenotyping using fluorescent antibodies to CD3 and CD57. Since lymphopenia can be present in LGL syndrome, an alternative criterion was the presence of LGLs comprising >25% of lymphocytes. Twenty-six patients with LGL and arthritis were recruited. Fourteen of these were recruited by Bowman in the UK, and have been described previously [2]. Two additional patients were recruited in the South East of England, and two from Sweden. Eight patients from the USA were studied, and these have been described previously [12]. All fulfilled the ACR criteria for RA.

Twenty-nine patients with LGL but no arthritis were studied. Twelve of these were recruited by Bowman, as described previously [2], and a further two patients were recruited in the UK. Fifteen US patients were also studied, and these have been described previously [12]. All patients, whether from the UK, Sweden or the USA, were of North European caucasoid origin.

Two control groups were used. The first was a group of 78 healthy individuals, who either worked in the Department of Tissue Typing at Guy's Hospital, or were visiting the department. These controls have been used in other genetic studies, and proved to have allele frequency distributions for polymorphisms in the IL-10 [13] and Fas [14] promoters similar to those found in other caucasoid populations [15, 16]. Eight of the Guy's controls were typed during this study as HLA DRB1*0401, and this group was augmented by a further 29 DRB1*0401 controls donated by the Department of Tissue Typing at King's College Hospital, collected in a similar manner to those from Guy's. All were North European caucasoids.

HLA typing
DNA was obtained from peripheral venous blood by proteinase K digestion and phenol/chloroform extraction. Some of the FS and LGL samples had been DR typed and DR4 subtyped using restriction fragment length polymorphism (RFLP) and HLA-DR probes as described previously [2]. These data were used where available. HLA typing was performed for HLA-A, -B and -Cw [17], HLA-DR [18] and DRB1*04 subtyping [19] by polymerase chain reaction sequence-specific priming (PCR-SSP), as described. Reactions were carried out as described, with some modifications. In brief, the final volume of all PCR reactions was 10 µl. PCR reaction mixtures consisted of 67 mM Tris base pH 8.8, 16.6 mM ammonium sulphate, 2 mM magnesium chloride, 0.01% (v/v) Tween 20, 200 µM of each dNTP, 1–4 µM of each allele-specific primer, 0.1–2 µM of control primers, 0.1 µg of DNA and 0.1875 units of Taq polymerase (Advanced Biotechnology, London, UK). In cases where amplification did not occur due to PCR inhibition, the reaction mixture was modified by increasing the concentration of magnesium chloride to 10 µM, and by the addition of 0.5 M betaine (Sigma, Poole, UK). In most cases, this strategy for the elimination of false negative PCR reactions [20] allowed successful typing to be carried out. For class I typing, a 796 base pair fragment from the third intron of HLA-DRB1 was used as the positive control, with primers TGCCAAGTGGAGCACCCAA and GCATCTTGCTCTGTGCAGAT. For HLA-DR and DRB1*04 subtyping, the positive control was human growth hormone, with primers CAGTGCCTTCCCAACCATTCCCTTA and ATCCACTCACGGATTTCTGTTGTGTTC, giving rise to a product of 486 base pairs. The DRB1*0401 controls were typed only for HLA-A*02, B*44 and Cw*0501 using four PCR reactions, rather than 96 for full class I typing. Reactions were carried out in a Perkin-Elmer 9700 thermal cycler, with cycling conditions as described previously [17–19]. Products were run on 1% agarose gels with ethidium bromide, and visualized using ultraviolet transillumination.

Statistical analysis
HLA antigen frequencies were compared between the FS, LGL and control groups using the chi-square test, and the odds ratio (OR) was calculated by the cross-product ratio. The Fisher exact test was used as appropriate. All comparisons used inferred genotype rather than allele frequencies, following long-established practice. Prior analysis showed no significant difference in associations when allele rather than genotype frequencies were used (data not shown). Bonferroni corrections were not carried out for the extended haplotype associated with DRB1*0401, since our a priori hypothesis was that this haplotype would be elevated in FS and LGL with arthritis. Correction for multiple comparisons was used where patient and control groups were divided into subgroups and compared with each other. Haplotypes were derived by eye from the genotypes.

Linkage disequilibrium between DRB1*0401 and HLA-A, -B and -C alleles was assessed using the standardized delta formula, normalized to take account of allele frequencies [21]. This statistic measures the magnitude of linkage disequilibrium on a scale of -1 to 1 and is less dependent on allele frequencies than the non-standardized formula. Positive and negative values indicate excess or deficient representation of class I alleles, respectively, in DRB1*0401 individuals compared with that expected by Hardy–Weinberg equilibrium.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The results of typing for class I in the various groups are given in Table 1Go. Although complete typing was carried out, the results of only the more common alleles are shown because of space constraints. Associations are shown as OR, with 95% confidence intervals (CI), and P-values. A significant association was found between HLA-A*02 and FS [OR 4.1 (1.9–8.9), P = 0.0003]. Similarly, there was an association between HLA-B*44 and LGL with arthritis [OR 3.5 (1.3–9.2), P = 0.01]. For HLA-Cw*0501, there was an association with FS [OR 3.3 (1.5–7.6), P = 0.003]. In each case, although there was a trend towards an association with the other condition (FS or LGL with arthritis, respectively), this did not achieve statistical significance. No other associations were noted between class I alleles and the diseases under consideration.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Comparison of HLA antigen frequencies between FS and LGL groups with and without arthritis, normal controls and DRB1*0401 controls

 
For all three HLA class I loci described above, the associations were lost on comparison with DRB1*0401+ controls. Furthermore, on comparing DRB1*0401+ FS patients and controls, frequencies for HLA-A*02 (74% vs 78%), HLA-B*44 (42% vs 49%) and HLA-Cw*0501 (40% vs 49%) were virtually identical. For DRB1*0401+ patients with LGL and arthritis (n = 18), 56% were A*02+, 61% B*44+, and 33% Cw*0501+, and none of these frequencies was significantly different from DRB1*0401+ controls.

The results of comparisons between FS patients with two, one or no HLA-DRB1*0401 haplotypes and HLA-DRB1*0401+ controls are shown in Table 2Go. The largest subgroup of FS patients, bearing one HLA-DRB1*0401 haplotype, showed similar frequencies of HLA-A*02 (68% vs 78%), B*44 (36% vs 46%) and Cw*0501 (32% vs 51%) to the DRB1*0401+ control group (78% of whom were heterozygous at the DR locus). Findings were similar on comparing DRB1*0401 homozygous FS patients and controls, but there were possible differences on comparing the small group of DRB1*04– FS patients with similar controls. Six of seven such FS patients had HLA-A*02 (86%) compared with 40% of controls (P = 0.04, corrected to 0.12 allowing for multiple comparisons).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Comparison of HLA class I antigen frequencies between FS patients homozygous, heterozygous and negative for HLA-DRB1*0401, and HLA-DRB1*0401+ controls. Values are shown as numbers (%)

 
Odds ratio for extended HLA haplotypes in FS and LGL syndrome with arthritis are shown in Table 3Go. The extended haplotype A*02;B*44;Cw*0501; DRB1*0401 was seen in 26% of FS patients, compared with 4% of controls [OR 9.5 (2.6–35), P = 0.0001]. For LGL with arthritis, the haplotype was seen in 16% of patients [OR 4.6 (1–22.4), P = 0.05]. Again, however, the extended haplotype was seen in 42% of DRB1*0401 controls, 36% of 0401+ FS patients, and 22% of 0401+ LGL patients with arthritis. These latter differences were not statistically significant.


View this table:
[in this window]
[in a new window]
 
TABLE 3. OR for HLA class I and II genotypes and extended haplotypes in FS and LGL with arthritis

 
There were different haplotypic associations between FS and LGL with arthritis. The haplotype A*02;Cw*0501;DRB1*0401 had a stronger association with FS [OR 7.9 (2.5–25.6), P = 0.0001] than LGL with arthritis [OR 3.5 (0.8–15.3), P = 0.08], although the difference between FS and LGL with regard to this haplotype was not statistically significant (P = 0.53). Similarly, the haplotype B*44;DRB1*0401 showed a stronger association with LGL and arthritis [OR 17.8 (4.4–71.8), P = 9 x 10-7] than FS [OR 12.5 (3.4–45.7), P = 6 x 10-6]. The B*44;DRB1*0401 haplotype was significantly more strongly associated with LGL and arthritis than with FS (P = 0.04).

Stronger than all the class I associations, however, were those seen with HLA-DRB1*0401. For FS, 78% were DRB1*0401+, compared with 11% of controls [OR 27.9 (10.3–75.5), P = 10-13], while for LGL with arthritis, 82% were DRB1*0401+ [OR 35.4 (9.6–131.3), P = 10-10]. In keeping with these findings, linkage disequilibrium (calculated from the control haplotype frequencies) was found between DRB1*0401 and A*02 ({Delta}s = 0.58), B*44 ({Delta}s = 0.14), and Cw*0501 ({Delta}s = 0.4).


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The results of this study demonstrate that there are significant associations between FS and HLA-A*02, Cw*0501. For LGL with arthritis, there is a strong association with HLA-B*44 and the haplotype B*44;DRB1*0401 is significantly more strongly associated with LGL than with FS. The extended haplotype HLA-A*02;B*44;Cw*0501 is associated with both diseases. However, these associations are weaker than, and secondary to, the primary HLA-DRB1*0401 association. The extended haplotype is common in normal HLA-DRB1*0401 controls. The controls were well matched with the patients, and have been shown not to be significantly different from the wider north European caucasoid population in other genetic studies. Furthermore, LGL without arthritis has no class I association, and no HLA-DRB1 association relating to RA.

MHC haplotypic associations have been reported for both FS and RA. Early studies of FS described MHC haplotypes in small numbers of patients. One study of seven B*07+ FS patients of north European caucasoid origin found the haplotype A*02;B*07;DRB1*04 in six [22]. In our larger sample, we had no increase in B*07 suggesting that selection bias may account for this unusual haplotype. Runge et al.described a family in which three siblings suffered from FS [23]. All had the haplotype A*02;B*15;Cw*03;DRB1*04. The study was carried out before DRB1*04 subtyping was available. We saw no such haplotype in our much larger group of patients. Hammond et al. described the B*44;DRB1*04 haplotype in FS, and extended it through the central MHC to include the complement genes C4A*3 and C4BQ*0 [24]. Centromeric to HLA-DR, an early study showed an association between FS and HLA-DQB1*0301 [25], although this was subsequently shown to be secondary to linkage disequilibrium with DRB1*0401 [1].

Relatively few studies have been carried out to examine the role of HLA class I in uncomplicated RA. In a study of 54 RA families, a B*15;DRB1*04 haplotype was described, and B*44;DRB1*04 was actually less frequent in RA families than in DRB1*04+ controls [26]. Two studies have found weak associations with a DRB1*04;B*27 haplotype, which we did not find [27, 28]. In a study of Mexican RA patients, a B*44;DRB1*04 haplotype was associated with RA, with a relative risk of 6 [29]. A recent case–control study demonstrated associations between RA and tumour necrosis factor (TNF) microsatellites within the central MHC, but these were secondary to DRB1*0401 [30]. This study also identified HLA-A*02;B*44; Cw*0501;DRB1*0401 as one of three extended haplotypes in RA.

All these studies, taken together, demonstrate a role for extended MHC haplotypes in susceptibility to RA and FS. Combining our data with those described above, a large susceptibility haplotype can be posited, particularly with regard to FS. From telomeric to centromeric, this is HLA-A*02; Cw*0501; B*44; TNFb5; TNFa6; TNFd4; C4A*3; C4BQ*0; DRB1*0401; DQB1*0301. Where multiple genes are related to a disease, at least three possibilities arise. Epistasis is interaction between loci, and implies that the genotype at one locus has an effect on the contribution at another locus, perhaps by acting on the same biological pathway. Plausible arguments can be constructed for interactions between, for example, TNF and HLA-DR, leading to increased disease susceptibility, but the data do not fit this model well. Disease heterogeneity is the converse of epistasis, where two or more loci are independent causes of disease and act via separate biological pathways. However, FS is a relatively homogeneous disease, and these loci are clearly not independent of each other. The most parsimonious explanation of this extended haplotype is the third possibility, linkage disequilibrium. The data suggest that the very strong association with DRB1*0401 is responsible for the entire extended haplotype.

We found some evidence of immunogenetic differences between FS and LGL with arthritis. Both diseases were associated with the extended haplotype. However, whereas FS was associated with HLA-A*02 and Cw*0501, LGL with arthritis showed stronger association with HLA-B*44. Moreover, there was a suggestion that HLA-A*02 might give rise to an increased susceptibility to FS in HLA-DRB1*04– patients. These diseases are rare, and so numbers were small. Therefore, the data must be interpreted with caution. However, the differences raise the possibility that genes in linkage disequilibrium with HLA class I, perhaps within the central MHC, influence whether RA progresses to FS or LGL with arthritis.


    Acknowledgments
 
Supported by grants from the Arthritis Research Campaign (ARC), Leukaemia Research Foundation and the Nuffield Foundation. GC is an ARC Research Fellow. We thank Dr Peter Donaldson (Tissue Typing, King's College Hospital, London) for donating the HLA-DRB1*0401 control panel, the many clinicians who allowed us to study their patients, and the patients themselves.


    Notes
 
Correspondence to: J. S. Lanchbury. Back


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Lanchbury JS, Jaeger EE, Sansom DM et al. Strong primary selection for the Dw4 subtype of DR4 accounts for the HLA-DQw7 association with Felty's syndrome. Hum Immunol1991;32:56–64.[Medline]
  2. Bowman SJ, Sivakumaran M, Snowden N et al. The large granular lymphocyte syndrome with rheumatoid arthritis. Immunogenetic evidence for a broader definition of Felty's syndrome. Arthritis Rheum1994;37:1326–30.[Medline]
  3. Wordsworth P, Pile KD, Buckely JD et al. HLA heterozygosity contributes to susceptibility to rheumatoid arthritis. Am J Hum Genet1992;51:585–91.[Medline]
  4. Gregersen PK. HLA associations with rheumatoid arthritis: a piece of the puzzle. J Rheumatol1992;32(Suppl.):7–11.
  5. Bowman SJ, Bhavnani M, Geddes GC et al. Large granular lymphocyte expansions in patients with Felty's syndrome: analysis using anti-T cell receptor V beta-specific monoclonal antibodies. Clin Exp Immunol1995;101:18–24.[Medline]
  6. d'Angeac AD, Monier S, Pilling D, Travaglio-Encinoza A, Reme T, Salmon M. CD57+ T lymphocytes are derived from CD57- precursors by differentiation occurring in late immune responses. Eur J Immunol1994;24:1503–11.[ISI][Medline]
  7. Loughran TP, Jr. Clonal diseases of large granular lymphocytes. Blood1993;82:1–14.[Abstract/Free Full Text]
  8. Wang EC, Borysiewicz LK. The role of CD8+, CD57+ cells in human cytomegalovirus and other viral infections [Review]. Scand J Infect Dis1995;99(Suppl.):69–77.
  9. Prince HE, Jensen ER. HIV-related alterations in CD8 cell subsets defined by in vitro survival characteristics. Cell Immunol1991;134:276–86.[ISI][Medline]
  10. Zanelli E, Krco CJ, Baisch JM, Cheng S, David CS. Immune response of HLA-DQ8 transgenic mice to peptides from the third hypervariable region of HLA-DRB1 correlates with predisposition to rheumatoid arthritis. Proc Natl Acad Sci USA1996;93:1814–9.[Abstract/Free Full Text]
  11. Arnett FC, Edworthy SM, Bloch DA et al. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum1988;31:315–24.[ISI][Medline]
  12. Starkebaum G, Loughran TP, Jr, Gaur LK, Davis P, Nepom BS. Immunogenetic similarities between patients with Felty's syndrome and those with clonal expansions of large granular lymphocytes in rheumatoid arthritis. Arthritis Rheum1997;40:624–6.[Medline]
  13. Coakley G, Mok CC, Hajeer AH et al. Interleukin-10 promoter polymorphisms in rheumatoid arthritis and Felty's syndrome. Br J Rheumatol1998;37:988–91.[Abstract/Free Full Text]
  14. Coakley G, Manolios N, Loughran TPJ, Panayi GS, Lanchbury JS. A Fas promoter polymorphism at position -670 in the enhancer region does not confer susceptibility to Felty's and large granular lymphocyte syndromes. Rheumatology1999;38:883–6.[Abstract/Free Full Text]
  15. Hajeer AH, Lazarus M, Turner D et al. IL-10 gene promoter polymorphisms in rheumatoid arthritis. Scand J Rheumatol1998;27:142–5.[Medline]
  16. Huang QR, Danis V, Lassere M, Edmonds J, Manolios N. Evaluation of a new Apo-1/Fas promoter polymorphism in rheumatoid arthritis and systemic lupus erythematosus patients. Rheumatology1999;38:645–51.[Abstract/Free Full Text]
  17. Bunce M, O'Neill CM, Barnardo MC et al. Phototyping: comprehensive DNA typing for HLA-A, B, C, DRB1, DRB3, DRB4, DRB5 & DQB1 by PCR with 144 primer mixes utilizing sequence-specific primers (PCR-SSP). Tissue Antigens1995;46:355–67.[ISI][Medline]
  18. Olerup O, Zetterquist H. HLA-DR typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours: an alternative to serological DR typing in clinical practice including donor-recipient matching in cadaveric transplantation. Tissue Antigens1992;39:225–35.[ISI][Medline]
  19. Zetterquist H, Olerup O. Identification of the HLA-DRB1*04, -DRB1*07, and -DRB1*09 alleles by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours. Hum Immunol1992;34:64–74.[ISI][Medline]
  20. Weissensteiner T, Lanchbury JS. Strategy for controlling preferential amplification and avoiding false negatives in PCR typing. Biotechniques1996;21:1102–8.[ISI][Medline]
  21. Brown MA, Kennedy LG, Darke C et al. The effect of HLA-DR genes on susceptibility to and severity of ankylosing spondylitis. Arthritis Rheum1998;41:460–5.[ISI][Medline]
  22. Klouda PT, Bidwell JL, Bodmer JG, Wasik A, Maddison PJ. A possible haplotype association in Felty's syndrome. Dis Markers1986;4:27–8.[Medline]
  23. Runge LA, Davey FR, Goldberg J, Boyd PR. The inheritance of Felty's syndrome in a family with several affected members. J Rheumatol1986;13:39–42.[Medline]
  24. Hammond A, Ollier W, Walport MJ. Effects of C4 null alleles and homoduplications on quantitative expression of C4A and C4B. Clin Exp Immunol1992;88:163–8.[Medline]
  25. So AK, Warner CA, Sansom D, Walport MJ. DQ beta polymorphism and genetic susceptibility to Felty's syndrome. Arthritis Rheum1988;31:990–4.[Medline]
  26. Sanders PA, Thomson W, Dyer PA, Grennan DM. Haplotypes bearing HLA-A, -B, and -DR: Bf and C4 genes in rheumatoid arthritis families. Tissue Antigens1989;33:21–9.[Medline]
  27. Paimela L, Leirisalo-Repo M, Helve T, Koskimies S. The prognostic value of HLA DR4 and B27 antigens in early rheumatoid arthritis. Scand J Rheumatol1993;22:220–4.[Medline]
  28. Sherritt MA, Tait B, Varney M et al. Immunosusceptibility genes in rheumatoid arthritis. Hum Immunol1996;51:32–40.[Medline]
  29. Avila-Portillo LM, Vargas-Alarcon G, Andrade F, Alarcon-Segovia D, Granados J. Linkage disequilibrium of HLA-DR3 and HLA-DR4 with HLA-B alleles in Mexican patients with rheumatoid arthritis. Clin Exp Rheumatol1994;12:497–502.[Medline]
  30. Hajeer AH, Worthington J, Silman AJ, Ollier WE. Association of tumor necrosis factor microsatellite polymorphisms with HLA-DRB1*04-bearing haplotypes in rheumatoid arthritis patients. Arthritis Rheum1996;39:1109–14.[ISI][Medline]
Submitted 21 May 1999; revised version accepted 28 October 1999.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Ann Rheum DisHome page
B Hellmich, A Ciaglo, H Schatz, and G Coakley
Autoantibodies against granulocyte-macrophage colony stimulating factor and interleukin-3 are rare in patients with Felty's syndrome
Ann Rheum Dis, July 1, 2004; 63(7): 862 - 866.
[Abstract] [Full Text] [PDF]


Home page
ASH Education BookHome page
J. P. Greer, M. C. Kinney, and T. P. Loughran Jr.
T Cell and NK Cell Lymphoproliferative Disorders
Hematology, January 1, 2001; 2001(1): 259 - 281.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (16)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Coakley, G.
Right arrow Articles by Lanchbury, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coakley, G.
Right arrow Articles by Lanchbury, J. S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?