Rheumatology 2000; 39: 758-763
© 2000 British Society for Rheumatology
Major histocompatibility complex phenotypes influence serum testosterone concentration
Faculty of Medicine, Memorial University of Newfoundland, St John's, Newfoundland, Canada
| Abstract |
|---|
|
|
|---|
Objectives. (a) To confirm our earlier observation that the phenotype HLA-DR4,7 occurs with higher frequency in male patients with rheumatoid arthritis (RA) than in female patients. (b) To test the hypothesis that DR7 is associated with low normal serum testosterone (Te) levels in healthy males; this might explain the increased frequency of DR4,7 in male patients since there appears to be a relationship between low serum Te and RA. (c) To characterize the association between HLA alleles and serum Te concentration in healthy males.
Methods. An additional 82 Newfoundland (NF) RA patients were HLA-DR typed and, combined with our earlier data and data from the 11th International Histocompatibility Workshop, gave HLA-DR and sex information on 373 RA patients. Ninety-four healthy NF males were typed for HLA, the microsatellite marker TNFa (located close to the tumour necrosis factor alpha gene) and complement factor B (BF). An additional 38 males were included, selected partly based on their HLA-B type.
Results. We confirmed our earlier finding of a higher frequency of HLA-DR4,7 in male RA patients compared with female RA patients (P < 0.01). Contrary to our expectations we found that DR7 was associated with higher than mean values of Te as were B5, B27, DR1, TNFa7 and BF F positivity. Conversely, low Te concentrations were found in men with B15, DR2, DR5, TNFa5 and who were BF F negative. In 28 male early-onset RA patients we did not find an increased frequency of HLA alleles associated with low Te levels as compared with the frequency in 41 late-onset patients, suggesting that if low Te level is a risk factor and is present before onset of RA then the level cannot be explained by an association between Te level and major histocompatibility complex (MHC) phenotype.
Conclusion. This study indicates that a man's MHC phenotype may influence his serum Te concentration, but the relationship of this, if any, to the pathogenesis of RA remains an area of speculation.
KEY WORDS: Rheumatoid arthritis, Serum testosterone, HLA, MHC.
| Introduction |
|---|
|
|
|---|
An association between HLA-DR4 and rheumatoid arthritis (RA) was first described 20 yr ago [1, 2] and has been confirmed in many later studies of Caucasoid patients [3] including the Newfoundland (NF) population [4]. In the NF population we noticed that the HLA genotype DR4,7 occurred three times more frequently in male patients than in female patients (unpublished). If this could be confirmed in other populations it would suggest that DR7 combined with DR4 is a risk factor in males but not in females.
RA occurs approximately three times more frequently in women than in men. An obvious difference between males and females is hormone concentrations. Serum levels of testosterone (Te) are, on average, reduced by about one-third in male RA patients compared with age- and sex-matched controls [57]. It is not known whether this reduced concentration is a consequence of the disease or is present before onset of the disease; however, one study suggests that the latter is the case in women [8]. Neither in men nor women was a reduced serum concentration of Te prior to disease onset found in a recent prospective study of a cohort of 19 072 adults [9]. A negative correlation between seropositivity and Te levels has been found [10, 11] and between Te levels and erythrocyte sedimentation rate (ESR) [10, 12]. One study found a beneficial effect [13] and another study found no positive effect of Te treatment on disease activity in men with RA [12].
Two studies have shown a correlation between HLA-B antigens and serum Te concentrations [7, 14]. One explanation for the increased frequency of HLA-DR4,7 in male patients might therefore be that DR antigens and Te concentrations are also correlated. If, for example, low Te concentration is associated with HLA-DR7 and is also a risk factor for RA in males then one would expect the frequency of the genotype DR4,7 to be increased in male patients. In this study we tested the hypothesis that normal, healthy males who are DR7 positive have a lower serum Te concentration than DR7-negative males. In addition, in order to characterize possible associations between serum Te concentrations and major histocompatibility complex (MHC) alleles we examined markers at other loci in the MHC (HLA-A, B, microsatellite marker TNFa and complement factor B).
| Materials and methods |
|---|
|
|
|---|
Patients
Eighty-two new NF Caucasoid RA patients were bled and typed for HLA. The results were added to those of similar patients included in a previous study [4]. The data from the 11th International Histocompatibility Workshop [15] (one of the few published sources with phenotype information on individual patients) were analysed. Information on sex and HLA phenotype was available on 336 of the RA patients included in the workshop; however, only 69 of these were Caucasoids, thus giving HLA-DR information on a total of 373 Caucasoid patients (see Table 1
|
Healthy subjects
Ninety-four healthy Caucasoid males, aged 2030 yr, were mainly Newfoundland university students. Fifty millilitres of blood were collected from each subject between 8.30 and 10.00 in the morning. Mononuclear cells were used for HLA typing while serum was stored at -70°C for later use. An additional 38 healthy men, all Caucasoids, aged 2030 yr, were included in the study and were selected for their HLA type. This latter group of men had been bled for another study within the last 4 months and their HLA-A and B antigens and their factor B (BF) types were known; the results from this group are included in Table 3
only. Sera had been stored at -70°C.
|
HLA typing
Mononuclear cells were prepared from whole blood by density gradient centrifugation. B cells were prepared using Lympho-Kwik (One Lambda, Canoga Park, CA, USA). HLA typing was performed using the microcytotoxicity method; typing plates were provided by the Canadian Red Cross.
Hormone measurements
Commercial kits from Immunocorp (Montreal, Quebec, Canada) were used to measure total serum Te levels by a radioimmunoassay. The highest standard included with the kits was 10 ng/ml. The normal adult values were given as 310 ng/ml. Each sample was measured in duplicate. Samples that fell outside the standard curve were re-measured after being diluted 1:2 with diluent buffer provided with the kit. Six samples still fell outside the standard curve, i.e. Te concentrations could not be measured but were higher than 20 ng/ml. These six individuals were excluded from the study of genetic markers and Te levels. Since we did not collect blood from them at a later date we do not know whether they had abnormally high Te levels at all times or, as is more likely, happened to have an extra high surge at the time we were sampling them. The interassay coefficient of variation was 8%.
TNFa alleles
Microsatellite TNFa alleles were identified by the method of Jongeneel et al. [17] with minor modifications. Briefly, using primers described by Nedospasov et al. [18], isolated human DNA was amplified by polymerase chain reaction using the primers IR1 (GCACTCCAGCCTAGGCCACAGA) and IR2 (GCCTCTAGATTTCATCCAGCCACAG) followed by a second round of amplification in which 5'-end 32P-labelled IR4 (TGTGTGTTGCAGGGGAGAGAGG) was added. Taq polymerase and buffers were purchased from Boehringer Mannheim Biochemica (Quebec, Canada). The alleles were separated on a 7% denaturing gel with 6 M urea at constant power (75 W) for 23 h until the bromophenol blue dye had reached the bottom of the gel. Differentiation of alleles varying by a single dinucleotide repeat was accomplished by comparison with a set of internal standards after autoradiography.
Factor B
Factor B typing was performed by high-voltage electrophoresis of serum in agarose gels followed by immunoprecipitation with antibody to factor B (Atlantic Antibodies, MN, USA) [19].
Statistical analysis
The MannWhitney two sample test was used to compare hormone levels between two groups (individuals positive vs negative for a MHC antigen); the
2-test (Fisher's exact test) was used to calculate P values for the
comparison of antigen frequencies in male vs female patients and in early-onset vs late-onset male patients (INSTAT). Significance levels were calculated at 5%.
| Results |
|---|
|
|
|---|
HLA-DR4,7 and RA
Overall, in 373 RA patients, the DR4,7 genotype occurred in 16% of the male patients and in 5% of the female patients (P = 0.0007, Table 1
Te concentration and HLA-DR7
The mean Te concentration for 88 healthy men (six of the 94 were excluded as described in the Materials and methods section) was 8.0 ± 3.12 ng/ml. Table 2
gives the mean Te concentration calculated for each MHC allele. Only those alleles that occurred in at least five of the participants are included. Splits have been pooled; for instance HLA-B12 includes Te values from 24 men who were HLA-B44 and from one person who was B45. Not unexpectedly the standard deviations were quite large. One reason for this is that most of the men were heterozygous and one individual's Te value will therefore appear in two columns for each locus; for example individual #GH3686 was HLA-B8,35; DR3,11, and his serum Te value was 11.8 ng/ml. The value 11.8 will be included both in the B8 column and in the B35 column, and in the DR3 and the DR5 column.
|
Of these 88 males, 18 were DR7 positive and 46 were DR7 negative (24 were not DR typed). The mean Te concentration for the DR7-positive males was 8.6 ± 4.2 ng/ml and for the DR7-negative it was 7.8 ± 2.8 ng/ml. The P value for this comparison was 0.9 (two-tailed), thus our hypothesis that DR7 is associated with low serum Te concentration was clearly shown to be incorrect. In a further analysis relating to phenotypes involved in RA susceptibility, three of the men were DR4,7 with a mean Te concentration of 11.4 ng/ml, while 34 carried neither DR4 nor 7 and had a mean Te concentration of 7.9 ng/ml. This difference was not significant (P = 0.13, two-tailed) and suggests that the combination of DR4 and DR7 is more likely to be associated with an elevation of Te concentration rather than the predicted reduction.
Te concentration and HLA-B
Ollier et al. [7] found that HLA-B15 was associated with low and HLA-B27 with high serum Te concentration in both healthy males and male patients with RA. We confirm this in our study of healthy males (Table 2
). Five men were B27 positive, with a mean of 9.5 ng/ml, six were B15 positive, with a mean of 5.7 ng/ml, and none carried both antigens (P = 0.015, one-tailed). Intrigued by the B27 vs B15 Te concentration difference we decided to investigate this aspect further. From a larger group of males who had been bled within the last 4 months and whose HLA-A, HLA-B and factor B types were known, we chose to measure serum Te in those who were B15 positive (n = 11) and those who were B27 positive (n = 4). To sample this population further, we made measurements on an additional 23 men who were neither B27 nor B15. These 38 males are referred to as group II in Table 3
, while the original 94 males are called group I. The mean Te concentration for group II was 7.38 ± 2.22 ng/ml.
The mean serum Te was, as predicted, higher in the B27-positive than the B15-positive men in group II (none was positive for both B27 and B15). Combining the data from group I and group II the difference in Te concentration between B27- and B15-positive men was significant (P = 0.007, Table 3
). One of the 17 who were B15 positive was B76, the rest were all B62.
Te and TNFa type
The TNFa locus is located between the HLA-B locus and the factor B locus. Of the 88 individuals in group I with known serum Te concentration, 64 had been typed for TNFa; 13 different TNFa alleles were identified in the group. Including only those alleles that occurred in at least five individuals, we found that the mean Te concentration was highest in the group who were TNFa7 positive and lowest in the group who were TNFa5 positive (Table 2
).
Te and factor B type
The factor B locus is positioned between the HLA-B and the HLA-DR loci and has two common variants, BF S and BF F. We divided the men into those who were BF F positive (phenotype BF F or BF FS) and those who were BF F negative (all others). High Te concentrations were associated with being BF F positive in both group I and group II (P = 0.0006, Table 3
).
HLA-B antigens and age at onset
If Te levels in male RA patients, before onset of the disease, are similar to those of healthy individuals, and if low serum Te level is a risk factor for RA, then we would expect that those individuals who carry the MHC markers associated with low Te levels would develop RA earlier than those who carry MHC markers associated with high Te levels. This would result in an increased frequency of low Te markers in the early-onset group of patients compared with the frequency of these markers in the late-onset group. Information on the age of onset and HLA type was available for 69 male NF RA patients. We divided the patients into those with RA onset before age 46 yr (n = 28 early onset) and those with onset at age 46 yr or later (n = 41, late onset). We defined low HLA-B antigens as those antigens associated with a mean Te level below the overall mean Te (8 ng/ml), i.e. HLA-B8, 14, 15, 17, 40 (Table 2
). The results did not support the hypothesis; B15 occurred in 21% of the patients with early onset and in 24% of the patients with late onset (P = 1.0, two-tailed, Fisher's exact test). Two low HLA-B antigens were present in 12% of the early-onset group and in 28% of the late-onset group (P = 0.2, two-tailed, Fisher's exact test). Looking at factor B, the trend was in the expected direction but was not statistically significant; 77% of early-onset patients were BF F negative while 68% of the late-onset patients were F negative (P = 0.4, Fisher's exact test). This would suggest that if low Te levels are indeed present before onset of the disease in the individuals with early onset, then the low Te levels cannot be explained by an association between Te levels and MHC phenotype
| Discussion |
|---|
|
|
|---|
We confirmed our earlier unpublished observation that the HLA genotype DR4,7 occurs more frequently in male patients than female patients with RA at least in some populations (in RA patients in the Manchester area of the UK, HLA-DR4,7 does not occur with increased frequency in male patients compared with female patients; W. Ollier, personal communication).
We had expected to find that healthy men who were HLA-DR7 had below average serum concentrations of Te. This could have explained why DR4,7 occurs more frequently in male patients with RA if one assumes that low Te concentrations are present before onset of the disease and that low Te concentrations are a risk factor for the disease. However, we found quite the opposite; DR7-positive men had Te concentrations above the mean value and the three who were DR4,7 actually had the highest value of all the groups we looked at. It is of course possible that Te concentrations start to fall earlier and decrease faster in men who are DR7 positive so that at middle age the DR7-positive men actually have lower serum Te concentrations than DR7-negative men. In the NF RA patients the mean age of onset for the DR4,7-positive men was the same as the mean for all the male NF patients (data not available for workshop patients).
If low serum Te concentration is a risk factor for developing RA then one might predict that a higher proportion of patients with early-onset RA would have an HLA phenotype where both HLA-B alleles were of the type associated with low Te levels, for example HLA-B15,40, as compared with patients with late onset. We found no support for such a hypothesis in our data. Contrary to expectations, an HLA phenotype with both HLA-B alleles associated with low Te levels occurred more frequently in the group of patients with late-onset RA but the difference was not statistically significant.
In the NF population the incidence of RA was highest for men in the age group 4655 yr of age. This group also had the lowest frequency of HLA-DR alleles with the shared epitope (DR4, DR1 and DR10), 78% being positive for the epitope, while it occurred in over 90% of the male patients in the other age groups. Serum Te concentration in men falls with age and the amplitude of the diurnal variation also falls [20]. Is it possible that low serum Te concentration is a risk factor only when the concentration over 24 h never reaches a certain level=
The medication taken by patients with RA affects hormone levels. Martens et al. [21] found low normal levels of Te [but significantly increased levels of follicle stimulating hormone (FSH) and luteinizing hormone (LH)] in male RA patients who were not taking steroids, while patients on prednisone had below normal levels of Te (but high normal FSH and LH levels). The question still remains whether hormonal abnormalities are present before onset of the disease and, if they are present, whether they constitute a risk factor.
Our results suggest that in healthy males there is an association between MHC phenotype and serum Te level. Considering (i) the fairly large intra-individual variation in serum Te concentration [20, 2224]; (ii) that our results are based on values from individuals who are heterozygous at most of the loci looked at; and (iii) that our donors were younger than those in the study by Ollier et al. [7], our results are remarkably similar to those found by Ollier. In general, antigens associated with Te levels above the overall mean in our study were also associated with high levels in their study, and antigens associated with levels below the overall mean in our study were also associated with low levels in their study. Major differences are only found for HLA-A11, B14 and B7. Of particular interest is the finding that in both groups of men looked at (groups I and II, Table 3
), and in the Ollier study, the Te value for those who were HLA-B27 was more than 20% higher than the mean value for those who were B15. These two HLA antigens are both associated with diseases, B27 with ankylosing spondylitis, and B15 with RA in some studies (not in the NF patients).
The TNFa locus is a microsatellite locus telomeric to the TNF
gene and has at least 14 alleles [17]. The locus is approximately equidistant from the factor B locus and the HLA-B locus. Jongeneel et al. [17] reported linkage disequilibrium between the various TNFa alleles and alleles at other MHC loci, for instance TNFa2 is in strong linkage disequilibrium with HLA-B8. Reports of TNFa alleles in extended haplotypes found in family studies [25] and in HLA workshop panel cells [26] have been published. For instance, while TNFa2 is usually found in the HLA-B8,DR3 haplotype it also occurs in other haplotypes (B17,DR7; B14,DR1 and B15,DR4).
We found that high Te concentrations were associated with the TNFa7 allele and low levels with TNFa5 and TNFa10. All of our 13 TNFa7 individuals had at least one of the other alleles (BF F, DR7, B12) that Jongeneel et al. [17] had demonstrated to be in linkage disequilibrium with TNFa7. These alleles, BF F, DR7, B12, are also associated with high Te levels (Table 2
). Thus, in general, our TNFa data support the concept that certain extended MHC haplotypes carry gene(s) that influence serum Te concentrations.
We were surprised to find the difference to be significant (P = 0.0006) between the mean Te concentration for those who were BF F positive vs those who were BF F negative. Since it is unlikely that the BF F protein itself affects serum Te our results would suggest that the F allele is a marker for MHC haplotypes carrying one or more genes that induce higher Te concentrations. In the NF population, the BF F allele is in linkage disequilibrium with the same alleles as in other Caucasoid populations, i.e. with HLA-B35, B12(44), HLA-DR1 and DR7 (unpublished). The men included in the present study were unrelated individuals so we cannot deduce their haplotypes from their phenotypes. However, HLA-B35 and B12, and HLA-DR1 and DR7 are associated with high Te levels (Table 2
) thus supporting the haplotype theory.
Taken together we have found that certain alleles at various loci in the MHC are associated with high (DR1, DR7, BF F, TNFa7, B5, B27), and others with low (DR2, DR5, TNFa5, TNFa10, B15, B40), serum Te concentrations. Just how the connection between the MHC and Te concentration comes about is not clear. The gene for 21-hydroxylase (21-OH) is known to be present in the MHC (between the factor B locus and the DR locus). This enzyme converts 17
-hydroxyprogesterone to deoxycortisol, and progesterone to deoxycorticosterone. Neither of these products is converted to Te. The 21-OH enzyme is active in the adrenals while most of the serum Te is produced in the testes. When the enzyme is non-functional, as in congenital adrenal hyperplasia, the resulting overproduction and accumulation of cortisol precursors result in excessive production of androgens. But it is unlikely that the 21-OH gene is the MHC gene that influences the serum Te concentration in healthy individuals. Nor is there any indication as to where the hypothetical gene product acts, namely at the level of the hypothalamus, or the pituitary or the testes. But the effects of such a product (or lack of product) are most clearly seen in individuals who are either HLA-B27 positive or HLA-B15 positive. If one was to speculate on where in the MHC the gene was located, the best guess would be near the HLA-B locus because of the larger range of mean Te values associated with alleles at this locus as compared with the range of values found for the other loci.
| Acknowledgments |
|---|
Supported in part by grants from The Arthritis Society (V.S., B.L.) and from The Medical Research Council of Canada (B.L.).
| Notes |
|---|
Correspondence to: B. Larsen, Immunology, Faculty of Medicine, Memorial University of Newfoundland, Prince Philip Drive, St John's, Newfoundland, Canada A1B 3V6.
| References |
|---|
|
|
|---|
- McMichael AJ, Sasazuki T, McDevitt HO, Payne RO. Increased frequency of HLA-Cw3 and HLA-Dw4 in rheumatoid arthritis. Arthritis Rheum1977;20:103742.[Web of Science][Medline]
- Stastny P. Association of the B-cell alloantigen DRw4 with rheumatoid arthritis. N Engl J Med1978;298:86971.[Abstract]
- Nepom GT, Erlich H. MHC class-II molecules and autoimmunity. Annu Rev Immunol1991;9:493525.[Web of Science][Medline]
- Larsen B, Alderdice CA, Hawkins D, Martin JR, Mitchell DM, Sheridan DP. Protective HLA-DR phenotypes in rheumatoid arthritis. J Rheumatol1989;16:4558.[Medline]
- Cutolo M, Balleari E, Giusti M, Monachesi M, Accardo S. Sex hormone status of male patients with rheumatoid arthritis: Evidence of low serum concentrations of testosterone at baseline and after human chorionic gonadotropin stimulation. Arthritis Rheum1988;31:13147.[Web of Science][Medline]
- Spector TD, Ollier W, Perry LA, Silman AJ, Thompson PW, Edwards A. Free and serum testosterone levels in 276 males: A comparative study of rheumatoid arthritis, ankylosing spondylitis and healthy controls. Clin Rheum1989;8:3741.[Medline]
- Ollier W, Spector T, Silman A et al. Are certain HLA haplotypes responsible for low testosterone levels in males? Disease Markers1989;7:13943.[Web of Science][Medline]
- Masi AT, Chatterton RT, Comstock GW, Malamet RL, Hochberg MC. Decreased androgenic-anabolic (AA) hormone levels in sera of white women before onset of RA: A controlled, prospective study. Arthritis Rheum1993;(Suppl.)36:S176.
- Heikkilä R, Aho K, Heliövaara M et al. Serum androgen-anabolic hormones and the risk of rheumatoid arthritis. Ann Rheum Dis1998;57:2815.
[Abstract/Free Full Text] - Gordon D, Beastall GH, Thomson JA, Sturrock RD. Androgenic status and sexual function in males with rheumatoid arthritis and ankylosing spondylitis. Q J Med1986;60:6719.[Web of Science][Medline]
- Spector TD, Perry LA, Tubb G, Silman AJ, Huskisson EC. Low free testosterone levels in rheumatoid arthritis. Ann Rheum Dis1988;47:658.
[Abstract/Free Full Text] - Hall GM, Larbre JP, Spector TD, Perry LA, Da Silva JAP. A randomized trial of testosterone therapy in males with rheumatoid arthritis. Br J Rheumatol1996;35:56873.
[Abstract/Free Full Text] - Cutolo M, Balleari E, Giusti M, Intra E, Accardo S. Androgen replacement therapy in male patients with rheumatoid arthritis. Arthritis Rheum1991;34:15.[Web of Science][Medline]
- Gerencer M, Tajic M, Kerhin-Brkljacic V, Ka
telan A. An association between serum testosterone level and HLA phenotype. Immunol Lett1982;4:1558.[Medline]
- Gojobori T, Inoko H, eds. The data book. 11th International Histocompatibility Workshop, Vol. 1. Mishima Print Corp. Mishima, Japan, 1991; Section 1.2.2:2115.
- Arnett FC, Edworthy SM, Bloch DA et al. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum1988;31:31524.[Web of Science][Medline]
- Jongeneel CV, Briant L, Udalova IA, Sevin A, Nedospasov SA, Combon-Thomsen A. Extensive genetic polymorphism in the human tumor necrosis factor region and relation to extended HLA haplotypes. Proc Natl Acad Sci USA1991;88:971721.
[Abstract/Free Full Text] - Nedospasov SA, Udalova IA, Kuprash DV, Turetskaya RL. DNA sequence polymorphism at the human tumor necrosis factor (TNF) locus. J Immunol1991;147:10539.[Abstract]
- Alper CA, Boenisch T, Watson L. Genetic polymorphism in human glycine-rich beta-glycoprotein. J Exp Med1972;135:6880.[Abstract]
- Bremner WJ, Vitiello MV, Printz PN. Loss of circadian rhythmicity in blood testosterone levels with aging in normal men. J Clin Endocrinol Metabol1983;56:127881.
[Abstract/Free Full Text] - Martens HF, Sheets PK, Tenover JS, Dugowson CE, Bremner WJ, Starkebaum G. Decreased testosterone levels in men with rheumatoid arthritis: effect of low dose prednisone therapy. J Rheumatol1994;21:142731.[Web of Science][Medline]
- Couwenbergs C, Knussmann R, Christiansen K. Comparisons of the intra- and inter-individual variability in sex hormone levels in men. Ann Hum Biol1986; 13:6372.[Medline]
- Ricós C, Arbós MA. Quality goals for hormone testing. Ann Clin Biochem1990;27:3538.
- Maes M, Mommen K, Hendrickx D et al. Components of biological variation, including seasonality, in blood concentrations of TSH, TT3, FT4, PRL, cortisol and testosterone in healthy volunteers. Clin Endocrinol1997; 46:58798.[Medline]
- Garcia-Merino A, Alper CA, Usuku K et al. Tumor necrosis factor (TNF) microsatellite haplotypes in relation to extended haplotypes, susceptibility to diseases associated with the major histocompatibility complex and TNF secretion. Hum Immunol1996;50:1121.[Web of Science][Medline]
- Degli-Esposti MA, Leelayuwat C, Daly LN et al. Updated characterization of the fourth ancestral haplotypes using Asia-Oceania histocompatibility workshop panel. Hum Immunol1995;44:128.[Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||