Rheumatology 2001; 40: 851-858
© 2001 British Society for Rheumatology
Original Papers |
Monoclonal anti-double stranded DNA antibody is a leucocyte-binding protein to up-regulate interleukin-8 gene expression and elicit apoptosis of normal human polymorphonuclear neutrophils
Institute of Clinical Medicine, National Yang-Ming University School of Medicine, Taipei,
1 Faculty of Medical Technology, National Yang-Ming University, Taipei,
2 Department of Medicine, Veterans General Hospital-Taipei, Taipei,
3 Department of Dermatology, Kaohsiung Medical University, Kaohsiung and
4 Department of Medicine and Institute of Molecular Medicine, National Taiwan University College of Medicine, Taipei, Taiwan
| Abstract |
|---|
|
|
|---|
Objectives. To determine whether anti-double stranded DNA (anti-dsDNA) autoantibody could bind and affect the functions of normal human polymorphonuclear neutrophils (PMN).
Methods. Normal human PMN were incubated with different concentrations of a monoclonal mouse anti-dsDNA antibody (12B3) or mouse isotype-matched IgG2a. The binding of anti-dsDNA and PMN was measured by flow cytometry and interleukin-8 (IL-8) gene expression in PMN was detected by enzyme-linked immunosorbent assay (ELISA) and reverse transcriptionpolymerase chain reaction (RTPCR). PMN apoptosis was justified by morphological changes. The cognate antigen(s) of anti-dsDNA on the PMN surface was identified by membrane biotinylation, immunoprecipitation and Western blot.
Results. The binding of PMN with anti-dsDNA was much higher than with non-specific mouse IgG2a (70.8 vs 2.0%). Anti-dsDNA at concentrations higher than 12.5 ng/ml significantly enhanced the production and mRNA expression of IL-8 by PMN. However, anti-dsDNA facilitated PMN apoptosis after 3 h incubation. Western blot analysis of biotinylated PMN cell lysates demonstrated that a 5052 kDa membrane molecule is the cognate antigen of anti-dsDNA.
Conclusions. Anti-dsDNA autoantibody up-regulates IL-8 gene expression and elicits activation-induced cell death (AICD) of human PMN via binding to a 5052 kDa membrane-expressed molecule.
KEY WORDS: Monoclonal anti-dsDNA antibody, Polymorphonuclear neutrophils, Interleukin-8, Apoptosis, Activation-induced cell death.
| Introduction |
|---|
|
|
|---|
Anti-double stranded DNA antibodies (anti-dsDNA) are not exclusively found in patients with systemic lupus erythematosus (SLE). IgG class anti-dsDNA has a high specificity for SLE and the serum titre can reflect the disease activity of this disorder [1, 2]. Increased susceptibility to infections is clinically a major cause of morbidity and mortality in SLE patients [3, 4]. Although treatment with glucocorticoids or immunosuppressants is an important contributory factor, decreased number [5, 6] as well as impaired functions [79] of polymorphonuclear neutrophils (PMN) per se are crucial to the susceptibility to bacterial infections in these patients. Many authors have demonstrated that the presence of antineutrophil antibodies (anti-PMN) correlated well with neutropenia in patients with SLE [1015]. However, the real pathological role and the identity of cognate antigen(s) of anti-PMN autoantibodies have not been reported. In our previous study, we demonstrated that polyclonal and monoclonal anti-dsDNA bound to human acidic ribosomal phosphoproteins (P0, P1 and P2) expressed on the surface of many cells and exerted cytostatic/cytotoxic effects on these cells [16]. The target cells of anti-dsDNA included glomerular mesangial cells, fibroblasts, astrocytes, hepatocytes, splenocytes and mononuclear cells (MNC) [1618]. These results suggest that anti-dsDNA is probably a neutrophil-binding antibody capable of deranging the neutrophil functions. To test this hypothesis, a monoclonal anti-dsDNA antibody, 12B3, derived from autoimmune MRL-lpr/lpr mice was used. Several novel biological/immunological activities of this antibody on human PMN were found.
| Materials and methods |
|---|
|
|
|---|
Generation and characterization of mouse monoclonal anti-dsDNA antibody
Monoclonal anti-dsDNA antibody, 12B3, was generated by fusing NS-1 myeloma cells and spleen cells from a 5-month-old autoimmune MRL-lpr/lpr mouse (Jackson Laboratories, Bar Harbor, ME, USA). The antibody was determined to be IgG2a subclass by a commercial enzyme-linked immunosorbent assay (ELISA) kit (Boehringer Ingelheim Biochemicals, GmbH, Mannheim, Germany). The calf thymus dsDNA binding capacity of 12B3, NS-1 cultured supernatant, and mouse isotype- and subclass-matched non-specific IgG2a purchased from Sigma Chemical Company (St. Louis, MO, USA) was measured by ELISA as described elsewhere [19]. Briefly, polystyrene microtitre plates (Corning Co., New York, NY, USA) were pre-coated with 150 µl of 0.5 mg/ml protamine chloride (Sigma) per well at 37°C for 2 h and then washed with phosphate-buffered saline (PBS), pH7.2. Commercially obtained calf thymus dsDNA (Sigma) was further purified and added to the microwells following the method of Rauch et al. [20]. The dsDNA binding capacity of 50 ng/ml 12B3 was 1.85 compared with 0.103 of 50 ng/ml mouse non-specific IgG2a at OD410 absorbance.
Isolation and culture of normal human PMN
Heparinized venous blood obtained from normal individuals was mixed with a quarter volume of 2% dextran solution (molecular weight 500 000) and incubated at 37°C for 20 min. The supernatant enriched in leucocytes was collected and diluted with the same volume of Hanks balanced salt solution. After centrifugation at 150 g for 30 min over a Ficoll-Hypaque density gradient cushion (specific gravity 1.077) (Pharmacia Biotech Far East Ltd., Hong Kong) PMN were obtained from the bottom. The purity and viability of the PMN suspension were greater than 95%, confirmed by Wright's stain and Trypan blue dye exclusion. The concentration of PMN was adjusted to 2 x 106/ml. PMN (0.5 ml) were mixed with 0.1 ml of different concentrations (6.25100 ng/ml) of 12B3 or mouse non-specific IgG2a and 0.4 ml of RPMI-1640 containing 10% fetal bovine serum (10% FBS-RPMI). The mixture was incubated at 37°C in 5% CO295% air for 24 h. The cell-free cultured supernatants were stored at - 20°C until used.
Detection of the binding of anti-dsDNA and PMN by flow cytometry
The binding of anti-dsDNA or mouse non-specific IgG2a and PMN was detected by FACSort flow cytometry (Becton-Dickinson, San Jose, CA, USA). Briefly, 0.5 ml of PMN (2 x 106/ml) was incubated with 0.1 ml of 12B3 (500 ng/ml) or mouse non-specific IgG2a (500 ng/ml) in an ice bath for 30 min. After three washes with PBS, pH 7.2, the cell pellets were then incubated with 1 : 2000 diluted FITC-labelled goat anti-mouse IgGs in an ice bath for another 30 min. After three washes, the percentage binding and mean fluorescence intensity (MFI, represented by the mean channel number) of PMN and anti-dsDNA were measured by flow cytometry at 488 nm excitation.
Measurement of interleukin-8 (IL-8) concentration in PMN cultured supernatants by ELISA
The IL-8 concentration of PMN cultured supernatants was measured by a commercially available ELISA kit (Quantikine, R&D System, Minneapolis, MN, USA). The minimal detectable concentration of IL-8 was 18.l pg/ml by the kit.
Detection of IL-8 mRNA expression in PMN by reverse transcriptionpolymerase chain reaction (RTPCR)
Total cellular RNA extraction and cDNA synthesis
Total cellular RNA was extracted from PMN (1 x 107/ml) after 2 h incubation with anti-dsDNA (50 ng/ml) or mouse non-specific IgG2a (50 ng/ml) at 37°C in 5% CO295% air according to the method reported by Chomczynski and Sacchi [21]. cDNA was synthesized by priming l µg/ml of total RNA at 42°C for 1 h in a final volume of 20 µl containing l µg of oligo-dT primer (Pharmacia Fine Chemicals, Piscataway, NJ, USA), 200 nmol of each dNTP (Pharmacia), and mMLV reverse transcriptase (Bethesda Research Laboratories, Gaithersburg, MD, USA) at 200 U/µg RNA.
Amplification of cDNA by PCR
An aliquot of cDNA was amplified by PCR using paired oligonucleotide primers specific for human IL-8 and glyceraldehyde-3-phosphate dehydrogenase (G3PDH, as an internal control) (Clontech Laboratories, Inc., Palo Alto, CA, USA).
Human IL-8:
- 5'ATGACTTCCAAGCTGGCCGTGGCT3' (sense)
- 5'TCTCAGCCCTCTTCAAAAACTTCTC3' (anti-sense)
- 5'TCTCAGCCCTCTTCAAAAACTTCTC3' (anti-sense)
Human G3PDH:
- 5'ACCACAGTCCATGCCATCAC3' (sense)
- 5'TCCACCACCCTGTTGCTGTA3' (anti-sense)
- 5'TCCACCACCCTGTTGCTGTA3' (anti-sense)
A Hybaid OmniGene DNA thermal cycler (Teddington, Middlesex, UK) was used to run 35 cycles of denaturation at 95°C for 1 min and annealing/extension at 60°C for 2 min for IL-8 and 26 cycles of denaturation at 94°C for 1 min and annealing/extension at 65°C for 2 min for G3PDH. The PCR products were then electrophoresed in 1.8% agarose gels using
X174 digested with HaeIII enzyme as the calibration markers. The cDNA fragments obtained by these sets of primers were 289 bp for IL-8 and 452 bp for G3PDH.
Identification of PMN apoptosis by morphology after haematoxylineosin stain
PMN (2 x 106/ml) were incubated with anti-dsDNA (50 ng/ml) or mouse non-specific IgG2a (50 ng/ml) for 1, 3 and 24 h at 37°C in 5% CO295% air. After the incubation, the cell suspension was cytospun at 2000 r.p.m. for 20 min. The cells attached to a glass slide were then dried, fixed and stained using a standard haematoxylineosin method. The cells with karyopyknosis/karyorrhexis in the nuclei were considered to be undergoing apoptosis.
Detection of the cognate antigen(s) of anti-dsDNA on the surface of human PMN
Membrane biotinylation of human PMN
Freshly isolated PMN (5 x 106/ml) were washed with borate buffer (50 mM sodium borate in 150 mM NaCl, pH 8.0). D-biotinoyl-
-aminocaproic acid N-hydroxy-succinimide ester (biotin-7-NHS; Boehringer Mannheim) was diluted with borate buffer pH 8.0 to a concentration of 100 µg/ml. Equal volumes of cell suspension and biotin-7-NHS solution were incubated at 4°C for 30 min with gentle agitation. The cells were then washed twice with Tris-buffer, pH 8.3. The cell lysates were prepared by repeated sonication in extraction buffer (50 mM borate, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, and 2.5 mM phenylmethylsulphonylfluoride, pH 8.0) and incubated for 30 min in an ice bath. The homogenates were further cleared by centrifugation at 12 000 r.p.m. for 20 min.
Detection of the cognate antigen(s) of anti-dsDNA in biotinylated PMN cell lysates after immunoprecipitation by Western blot
The biotinylated PMN lysates were subjected to two rounds of immunoprecipitation, starting with human non-specific
-globulin-conjugated agarose beads (Sigma) and then reacted with streptavidin-conjugated beads (Pierce, Rockford, IL, USA) at 4°C overnight. After PBS washes, the beads were suspended in 2x sodium dodecyl sulphate (SDS) sample buffer and heated at 100°C for 5 min to separate the membrane proteins and beads. After centrifugation, the clear supernatants were electrophoresed using 10% SDSpolyacrylamide gel electrophoresis (SDSPAGE) and probed by anti-dsDNA in a Western blot. The signal was detected by an enhanced chemiluminescence protein detection kit (Amersham International plc, Little Chalfont, Buckinghamshire, UK) according to the manufacturer's instructions.
In addition, a number of cells including human MNC and red blood cells (RBC), K-562 (human erythroleukaemia cell line), HL-60 (human promonocytic leukaemia cell line), Jurkat cells (human T-lymphoma cell line), RBA-1 (rat brain astrocyte cell line), and RKO cells (human colon cancer cell line) were also used in the same experiment.
Statistical analysis
The results are presented as mean ± standard deviation (S.D.). Statistical significance was assessed by KruskalWallis one-way analysis of variance on ranks (Dunnett's method) for multiple comparisons in the Sigma Stat software program.
| Results |
|---|
|
|
|---|
Binding of anti-dsDNA with PMN
A representative case showing the binding of PMN with anti-dsDNA is demonstrated in Fig. 1
|
Effect of anti-dsDNA on IL-8 gene expression of normal human PMN
To determine whether anti-dsDNA can modulate IL-8 gene expression of PMN, different concentrations of anti-dsDNA from 6.25 to 100 ng/ml were tested. We found that anti-dsDNA at concentrations higher than 12.5 ng/ml significantly enhanced IL-8 protein production (Fig. 2
) and mRNA expression (Fig. 3
) of PMN with a maximal effect at 25 ng/ml compared with the mouse non-specific IgG2a (100 ng/ml).
|
|
Kinetic effect of anti-dsDNA on normal human PMN apoptosis
In an attempt to determine whether anti-dsDNA affects PMN apoptosis, normal human PMN were incubated with 50 ng/ml of anti-dsDNA or mouse non-specific IgG2a at 37°C for 1, 3 and 24 h. The cells were then cytospun, fixed and stained with haematoxylineosin solution for morphological observation. As shown in Fig. 4
, karyopyknotic/karyorrhexic nuclei began to appear in anti-dsDNA-treated, but not in mouse non-specific IgG2a-treated PMN after 3 h incubation. In addition, the number of apoptotic cells in anti-dsDNA-treated PMN was much greater than in mouse non-specific IgG2a-treated PMN after 24 h incubation. The same experiment was repeated five times with a similar tendency.
|
Detection of the cognate antigen(s) of anti-dsDNA on the surface of PMN and other cells
A number of cells, including human PMN, MNC and RBC, K-562, HL-60, Jurkat, RBA-1 and RKO, were membrane biotinylated, lysed, immunoprecipitated and probed by anti-dsDNA in Western blot to detect the cognate antigen(s) of anti-dsDNA on the cell surface. As shown in Fig. 5
, a 5052 kDa molecule expressed on the surface of human PMN and MNC, K-562, HL-60, and Jurkat T cells, but not on RKO (human colon cancer cell line) or human RBC, bound with anti-dsDNA. Instead, high (115 kDa) and low (30 kDa) molecular weight molecules expressed on the surface of the rat brain astrocyte cell line (lane 4) reacted with anti-dsDNA.
|
| Discussion |
|---|
|
|
|---|
Anti-dsDNA antibodies are the classical autoantibodies that characterize SLE and play a major role in lupus pathogenesis. The DNAanti-DNA or DNAhistoneanti-DNA immune complexes formed in the circulation or in situ deposit in different tissues eliciting tissue damage [22]. However, many authors have demonstrated that antinuclear or anticytoplasmic autoantibodies can bind directly to different kinds of cells and cause cellular cytotoxicity through an immunological cross-reactivity [1619, 23, 24]. In our previous reports, we found that polyclonal anti-dsDNA purified from active SLE exerted diverse effects on human MNC [18, 25], cultured rat glomerular mesangial cells and different cell lines [17, 2628] by binding to the cell surface-expressed acidic ribosomal phosphoproteins P0, P1 and P2 [16, 17, 27]. Increased susceptibility to infections is clinically a major cause of morbidity and mortality in patients with SLE. It is conceivable that elevated lupus disease activity, administration of glucocorticoids/immunosuppressants, hypoalbuminaemia, neutropenia and functional impairment of PMN are associated with increased infections in patients with SLE [3, 4, 14, 15].
Mature neutrophils have long been regarded as terminally differentiated cells incapable of protein synthesis and committed to death within 72 h via an apoptotic mechanism [29, 30]. Recently, many authors reported that PMN could express and produce a number of important cytokines and chemokines mRNA, including IL-1, IL-6, IL-8, IL-12, tumour necrosis factor
(TNF-
), granulocyte-colony stimulating factor, granulocyte-macrophage-colony stimulating factor, macrophage-chemoattractant protein 1, macrophage inflammatory protein 1
and macrophage inflammatory protein 1ß [31, 32]. Among these, IL-8 is of particular importance because: (a) IL-8 is produced in abundance by normal PMN either spontaneously or after stimulation; (b) IL-8 is a potent specific chemotactic factor and activator of PMN for stimulating chemotaxis, release of lysosomal enzymes and generation of reactive oxygen species [33, 34]; (c) IL-8 acts as an autocrine regulator of PMN to increase the recruitment and activation of PMN in the inflammatory sites [9, 31, 32]. Accordingly, an abnormal regulation of the IL-8PMNIL-8 amplification loop would remarkably influence the altitude of the inflammatory responses leading to overwhelming or defective tissue inflammation [9]. It is conceivable that the presence of neutrophil-binding autoantibodies in the circulation correlated with neutropenia in the patients with active SLE [1013]. However, the pathological roles of antineutrophil autoantibodies in abnormal neutrophil functions and the identification of the cognate antigens of the antibodies have not been reported in the literature. Because of the polyreactive and cross-reactive properties of anti-dsDNA [1618, 23, 24, 27, 28], it is possible that anti-dsDNA is a potential antineutrophil antibody capable of deranging the functions of PMN. In the present study, three original findings were noted: (a) anti-dsDNA can bind to a 5052 kDa membrane-expressed molecule on normal human PMN [Figs 1
and 5
(lane 8)]; (b) anti-dsDNA up-regulates the IL-8 gene expression of normal human PMN (Figs 2
and 3
); (c) anti-dsDNA accelerates PMN apoptosis via an activation-induced cell death (AICD) mechanism (Fig. 4
). These original observations suggest that anti-dsDNA is a kind of antineutrophil autoantibody, but not a non-specific neutrophil binder by adhering to the surface IgG Fc receptors, as reported by Starkebaum and Arend [10]. The binding of anti-dsDNA to PMN simultaneously turns on IL-8 and apoptosis-related genes. However, these in vitro effects of a monoclonal anti-dsDNA antibody derived from an autoimmune MRL-lpr/lpr mouse in this study cannot directly reflect the in vivo or in vitro pathological effects of polyclonal anti-dsDNA autoantibodies obtained from patients with SLE. Immunologically, IL-8 and other
-chemokines are implicated as major participants in the initiation and amplification of the acute inflammatory reaction [35]. IL-8 can stimulate the vascular endothelial cells and facilitate the adhesion and emigration of PMN from blood vessels into tissues such as lungs or kidneys to cause tissue damage [3639]. Our findings are quite similar to the report of Rekvig and Hannestad [40] who demonstrated that certain polyclonal antinuclear antibodies cross-reacted with the molecules expressed on the surface membrane of human lymphocytes and granulocytes. In the present study, we further identified that a 5052 kDa membrane protein is the cognate antigen of anti-dsDNA. In our preliminary study, we found that the amino acid sequence of this 5052 kDa membrane-expressed molecule showed a high homology with hnRNP-A2 molecule. But the real nature of this molecule needs further investigation.
Biologically, apoptosis is intimately linked to cell stimulation and proliferation [41, 42]. Cell activation and cell death are inseparable and become a continuous spectrum of the fate of the cells after activation. This AICD phenomenon is commonly found in antigen- or mitogen-activated immune cells [43, 44] to maintain the immune homeostasis. Carvalho et al. [45] reported that IgG class anti-endothelial cell autoantibodies derived from SLE or systemic vasculitis stimulated endothelial cells to release IL-1 and an as-yet-unidentified mediator which enhance intercellular adhesion molecule-1, vascular cell adhesion molecule-1 and E-selectin expression and leucocyte adhesion in an autocrine manner. However, the outcome of these activated endothelial cells was not mentioned in that study. Lai et al. [46] demonstrated that polyclonal anti-dsDNA autoantibodies enhanced the gene expression of IL-8, transforming growth factor ß, and nitric oxide synthase in cultured umbilical vein endothelial cells. But the number of endothelial cells in apoptosis increased in parallel with gene expression. Our study suggests that the presence of anti-dsDNA in the serum of patients with active SLE not only stimulates circulating PMN to produce more IL-8 but also transduces signals for AICD to maintain immunological homeostasis and prevent overwhelming tissue inflammation in vivo.
Undoubtedly, there are at least four drawbacks in this study: (a) we did not characterize the nature of the 5052 kDa cognate antigen of anti-dsDNA expressed on human PMN; (b) the signal transduction pathway involving IL-8 and AICD gene expression in PMN after binding with anti-dsDNA was not studied, although protein kinase C
is a potential candidate for it [47]; (c) the effect of anti-dsDNA in apoptosis-related gene expression of PMN, such as Fas, FasL, p53, c-myc, and bcl-2 family was not investigated [28, 30]; (d) the correlation of anti-dsDNA, IL-8, leucopenia, and bacterial infection rate in the patients with active SLE was not elucidated. However, our results are quite important in understanding the pathological role of anti-dsDNA in accelerating apoptosis and abnormal functions of neutrophils in patients with SLE.
In conclusion, anti-dsDNA not only enhances neutrophil IL-8 gene expression but also accelerates the apoptosis of normal human PMN via a mechanism of AICD which is frequently found in patients with active SLE.
| Acknowledgments |
|---|
This study was supported by grants from National Science Council (NSC87-2314-B010-022) and National Health Research Institute (DOH87-HR-508), Taipei, Taiwan.
| Notes |
|---|
Correspondence to: C.-L. Yu, Department of Medicine, National Taiwan University Hospital, 7 Chung-Shan South Road, Taipei, Taiwan 100.
| References |
|---|
|
|
|---|
- Lightfoot RW Jr, Hughes GV. Significance of persisting serologic abnormalities in SLE. Arthritis Rheum1976;19:83743.[Medline]
- Swaak AJG, Aarden LA, Statius VAN, Feltkamp TEW. Anti-dsDNA and complement profiles as prognostic guides in systemic lupus erythematosus. Arthritis Rheum1979;22:22635.[Web of Science][Medline]
- Staples PJ, Gerding DN, Decker JL, Gordon RS Jr. Incidence of infection in systemic lupus erythematosus. Arthritis Rheum1974;17:110.[Web of Science][Medline]
- Ginzler E, Diamond H, Kaplan D, Weiner M, Schlesinger M, Seleznick M. Computer analysis of factors influencing frequency of infection in systemic lupus erythematosus. Arthritis Rheum1979;21:3744.[Web of Science]
- Dubois EL, Tuffanelli DL. Clinical manifestations of systemic lupus erythematosus. Computer analysis of 520 cases. J Am Med Assoc1964;190:10411.
- Estes D, Christian CL. The natural history of systemic lupus erythematosus by prospective analysis. Medicine1971;50:8595.[Medline]
-
Landry M. Phagocyte function and cell-mediated immunity in systemic lupus erythematosus. Arch Dermatol1977;113:14754.
[Abstract/Free Full Text] -
Yu C-L, Chang K-L, Chiu C-C, Chiang BN, Han S-H, Wang S-R. Defective phagocytosis, decreased tumour necrosis factor-
production and lymphocyte hyporesponsiveness predispose patients with systemic lupus erythematosus to infections. Scand J Rheumatol1989;18:97105.[Web of Science][Medline]
- Hsieh S-C, Tsai C-Y, Sun K-H et al. Decreased spontaneous and lipopolysaccharide stimulated production of interleukin 8 by polymorphonuclear neutrophils of patients with active systemic lupus erythematosus. Clin Exp Rheumatol1994;12:62733.[Web of Science][Medline]
- Starkebaum G, Arend WP. Neutrophil-binding immunoglobulin G in systemic lupus erythematosus. Evidence for presence of both soluble immune complexes and immunoglobulin G antibodies to neutrophils. J Clin Invest1979; 64:90212.
- Rustagi AK, Currie MS, Logue GL. Complement-activating anti-neutrophil antibody in systemic lupus erythematosus. Am J Med1985;78:9717.[Medline]
- Hadley AG, Byron MA, Chapel HM, Bunch C, Holbwn AM. Antigranulocyte opsonic activity in sera from patients with systemic lupus erythematosus. Br J Haematol1987;65:615.[Medline]
- Sipos A, Csortos C, Sipka S, Gergely P, Sonkoly I, Szegedi G. The antigen-receptor specificity of antigranulocyte antibodies in patients with SLE. Immunol Lett1988;19:32934.[Medline]
- Vitali C, Bencivelli W, Isenberg DA et al. European Consensus Study Group for Disease Activity in SLE. Disease activity in systemic lupus erythematosus: report of the Consensus Study Group of the European Workshop for Rheumatology Research I. A description analysis of 704 European lupus patients. Clin Exp Rheumatol1992;10:52739.[Web of Science][Medline]
-
Koh WH, Fong KY, Boey ML, Feng PH. Systemic lupus erythematosus in 61 Oriental males. A study of clinical and laboratory manifestations. Br J Rheumatol1994;33:33942.
[Abstract/Free Full Text] - Sun K-H, Liu W-T, Tsai C-Y, Tang S-J, Han S-H, Yu C-L. Anti-dsDNA antibodies cross-react with ribosomal P proteins expressed on the surface of glomerular mesangial cells to exert a cytostatic effect. Immunology1995;85:2629.[Web of Science][Medline]
- Sun K-H, Liu W-T, Tang S-J et al. The expression of acidic ribosomal phosphoproteins on the surface membrane of different tissues in autoimmune and normal mice which are the target molecules for anti-double-stranded DNA antibodies. Immunology1996;87:36271.[Web of Science][Medline]
-
Sun K-H, Yu C-L, Tang S-J, Sun G-H. Monoclonal anti-double-stranded DNA autoantibody stimulates the expression and release of IL-1ß, IL-6, IL-8, IL-10 and TNF-
from normal human mononuclear cells involving lupus pathogenesis. Immunology2000;99:35260.[Web of Science][Medline]
- Faaber P, Puke GPM, van de Putte LBA, Capel PJA, Berden JHM. Cross-reactivity of human and murine anti-DNA antibodies with heparin sulfate: the major glycosaminoglycan in glomerular basement membranes. J Clin Invest1986;77:182430.
- Rauch J, Massicotte H, Wild J, Tannenbaum H. Sensitive solid phase radioimmunoassay for the detection of anti-DNA autoantibodies. J Rheumatol1985;12:4826.[Medline]
- Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guadinidiumthiocyanatephenol chloroform extraction. Anal Biochem1987;162:1569.[Web of Science][Medline]
- Livinsky RJ, Cameron JS, Soothill JF. Serum immune complexes and disease activity in lupus nephritis. Lancet1977;1:5647.[Web of Science][Medline]
- Jacob L, Lety M-A, Louvard D, Bach J-F. Binding of monoclonal anti-DNA autoantibodies to identical protein(s) present at the surface of several cell types involved in lupus pathogenesis. J Clin Invest1985;75:3157.
- Raz E, Ben-Bassat H, Davidi T, Shlomai Z, Eilat D. Cross-reactions of anti-DNA autoantibodies with cell surface proteins. Eur J Immunol1993;23:38390.[Web of Science][Medline]
- Yu C-L, Chang K-L, Chiu C-C, Chiang BN, Han S-H, Wang S-R. Alteration of the mitogenic responses of mononuclear cells by anti-dsDNA antibodies resembling immune disorders in patients with systemic lupus erythematosus. Scand J Rheumatol1989;18:26576.[Medline]
-
Tsai C-Y, Wu T-H, Sun K-H, Yu C-L. Effect of antibodies to double stranded DNA, purified from serum samples of patients with active systemic lupus erythematosus, on the glomerular mesangial cells. Ann Rheum Dis1992;51:1627.
[Abstract/Free Full Text] - Tsai C-Y, Wu T-H, Sun K-H, Liao T-S, Lin W-M, Yu C-L. Polyclonal IgG anti-dsDNA antibodies exert cytotoxic effect on cultured rat mesangial cells by binding to cell membrane and augmenting apoptosis. Scand J Rheumatol1993;22:16271.[Web of Science][Medline]
- Yu C-L, Huang M-H, Tsai C-Y et al. The effect of human polyclonal anti-dsDNA autoantibodies on apoptotic gene expression in cultured rat glomerular mesangial cells. Scand J Rheumatol1998;27:5460.[Web of Science][Medline]
- Hsieh S-C, Huang M-H, Tsai C-Y et al. The expression of genes modulating programmed cell death in normal human polymorphonuclear neutrophils. Biochem Biophys Res Commun1997;233:7006.[Web of Science][Medline]
-
Liles WC, Kiener PA, Ledbetter JA, Aruffo A, Klebanoff SJ. Differential expression of Fas (CD95) and Fas ligand on normal human phagocytes: implications for regulation of apoptosis in neutrophils. J Exp Med1996;184:42940.
[Abstract/Free Full Text] - Lloyd AR, Oppenheim JJ. Poly's lament: the neglected role of the polymorphonuclear neutrophil in the afferent limb of the immune response. Immunol Today1992;13:16972.[Web of Science][Medline]
- Cassatella MA. The production of cytokines by polymorphonuclear neutrophils. Immunol Today1995;16:216.[Web of Science][Medline]
- Baggiolini M, Walt A, Kunkel SL. Neutrophil-activating peptide-l/interleukin 8, a novel cytokine that activates neutrophils. J Clin Invest1989;84:10459.
- Willems J, Joniau M, Cinque S, van Danne J. Human granulocyte chemotactic peptide (IL-8) as a specific neutrophil degranulator: comparison with other monokines. Immunology1989;67:1402.
- Harada D, Sekido N, Akahoshi T, Wada T, Mukaido N, Matsushima K. Essential involvement of interleukin-8 (IL-8) in acute inflammation. J Leukoc Biol1994;56: 55964.[Abstract]
- Rot A, Hub E, Middleton J et al. Some aspects of IL-8 pathophysiology III: chemokine interaction with endothelial cells. J Leukoc Biol1996;59:3944.[Abstract]
- Rot A. Endothelial cell binding of NAP-1/IL-8: role in neutrophil emigration. Immunol Today1992;13:2914.[Web of Science][Medline]
- Mulligan M, Jones M, Bolanowiski M et al. Inhibition of lung inflammatory reactions in rats by an anti-human IL-8 antibody. J Immunol1993;150:558595.[Abstract]
-
Wada T, Tomosugi N, Naito T et al. Prevention of proteinuria by the administration of anti-interleukin-8 antibody in experimental acute immune complex-induced glomerulonephritis. J Exp Med1994;180:113540.
[Abstract/Free Full Text] - Rekvig OP, Hannestad K. Certain polyclonal anti-nuclear antibodies cross-react with the surface membrane of human lymphocytes and granulocytes. Scand J Immunol1977;6:10417.[Medline]
-
Klas C, Debatin KM, Jonker RR, Krammer PH. Activation interferes with the APO-1 pathway in mature human T cells. Int Immunol1993;5:62531.
[Abstract/Free Full Text] - Mountz JD, Wu J, Cheng J, Zhou T. Autoimmune disease: a problem of defective apoptosis. Arthritis Rheum1994;37:141520.[Web of Science][Medline]
- Zheng L, Fisher G, Miller RE, Peschon J, Lynch DH, Lenardo MJ. Induction of apoptosis in mature T cells by tumour necrosis factor. Nature1995;377:34851.[Medline]
-
Nagata S, Goldstein P. The Fas death factor. Science1995;267:144956.
[Abstract/Free Full Text] - Carvalho D, Savage COS, Isenberg D, Fearson JD. IgG anti-endothelial cell autoantibodies from patients with systemic lupus erythematosus or systemic vasculitis stimulate the release of two endothelial cell-derived mediators, which enhance adhesion molecule expression and leukocyte adhesion in an autocrine manner. Arthritis Rheum1999;42:63140.[Web of Science][Medline]
- Lai KN, Leung JK, Lai CKW. Effect of anti-DNA autoantibodies on the gene expression of interleukin 8, transforming growth factor-ß, and nitric oxide synthase in cultured endothelial cells. Scand J Rheumatol1997;26:4617.[Web of Science][Medline]
-
Villalba M, Kasibhatla S, Genestier L, Mahboubi A, Green OR, Altman A. Protein kinase C
cooperates with calcineurin to induce Fas ligand expression during activation-induced T cell death. J Immunol1999; 163:58139.[Abstract/Free Full Text]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S.-C. Hsieh, T.-H. Wu, C.-Y. Tsai, K.-J. Li, M.-C. Lu, C.-H. Wu, and C.-L. Yu Abnormal in vitro CXCR2 modulation and defective cationic ion transporter expression on polymorphonuclear neutrophils responsible for hyporesponsiveness to IL-8 stimulation in patients with active systemic lupus erythematosus Rheumatology, February 1, 2008; 47(2): 150 - 157. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Guo, J. C. K. Leung, L. Y. Y. Chan, T. M. Chan, and K. N. Lai The pathogenetic role of immunoglobulin G from patients with systemic lupus erythematosus in the development of lupus pleuritis Rheumatology, March 1, 2004; 43(3): 286 - 293. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





