Skip Navigation


Rheumatology Advance Access originally published online on February 28, 2003
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
42/4/563    most recent
keg191v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Zeuner, R. A.
Right arrow Articles by Verthelyi, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeuner, R. A.
Right arrow Articles by Verthelyi, D.
Related Collections
Right arrow Systemic Lupus Erythematosus and Autoimmunity
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Rheumatology 2003; 42: 563-569
© 2003 British Society for Rheumatology

Response of peripheral blood mononuclear cells from lupus patients to stimulation by CpG oligodeoxynucleotides

R. A. Zeuner1,3, D. M. Klinman1,, G. Illei2, C. Yarboro2, K. J. Ishii1, M. Gursel1 and D. Verthelyi1

1 Center for Biologics Evaluation and Research/Food and Drug Administration, Bethesda, Maryland, USA,
2 NIAMS, National Institutes of Health, Bethesda, Maryland, USA and
3 II. Medical Clinic, University of Kiel, Germany


    Abstract
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 References
 
Objectives. Increased levels of hypomethylated CpG-containing DNA in sera from patients with systemic lupus erythematosus (SLE) may contribute to the initiation and/or perpetuation of the disease. This study characterizes the in vitro response of peripheral blood mononuclear cells (PBMC) from SLE patients to CpG DNA.

Methods. Secretion of cytokines and IgM, cell proliferation and up-regulation of co-stimulatory molecules were evaluated in PBMC from SLE patients (n=24) and normal controls (n=24) after stimulation with synthetic oligodeoxynucleotides (ODN) containing CpG motifs.

Results. Up-regulation of co-stimulatory molecules and the secretion of interferon-{alpha} and interleukin-6 (IL-6) in response to CpG ODN was significantly reduced in monocytes and dendritic cells from SLE patients. Secretion of interferon-{gamma} by natural killer (NK) cells was also reduced. In contrast, the IgM and IL-10 response of B cells to CpG ODN was normal.

Conclusion. Monocytes, dendritic cells and NK cells from SLE patients respond abnormally to CpG ODN stimulation, which may contribute to the cytokine imbalance observed in SLE.

KEY WORDS: SLE, Innate immune system, CpG oligodeoxynucleotide, Toll-like receptor, Dendritic cells.


    Introduction
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 References
 
Systemic lupus erythematosus is a multifactorial (genetic, infectious, hormonal, etc.) autoimmune disease characterized by the development of autoreactive T and B cells with specificity for ds-DNA and other nuclear antigens. Patients with SLE have impaired maturation of monocytes into dendritic cells leading to defects in antigen presentation [1, 2]. Additionally, the number and function of natural killer (NK) cells is reduced [3] and the cytokine milieu is altered with reduced interferon-{gamma} and an increased ratio of cells secreting interleukin-10 (IL-10):interferon-{gamma} [4].

It is well established that bacterial DNA containing unmethylated ‘CpG motifs' are inherently immunostimulatory, triggering B cells to proliferate and secrete IgM and IL-10, monocytes/dendritic cells to secrete IL-6 and interferon-{alpha}, and NK cells to produce interferon-{gamma} [5]. Several findings suggest that bacterial DNA may play a role in the development and/or progression of SLE. First, lupus patients have increased levels of free DNA and DNA–anti-DNA immune complexes in their serum. These immune complexes contain hypomethylated CpG-rich DNA [68], leading Sato et al. [8] to speculate that such DNA might be of bacterial origin. Second, CpG-rich DNA may persist for prolonged periods in lupus patients due to a decrease in DNase activity [9, 10]. Third, animal studies show that CpG DNA stimulates autoantibody production [11, 12]. Finally, Pisetsky et al. reported that the anti-DNA autoantibodies in SLE patients cross-react with bacterial and mammalian DNA [13]. We therefore hypothesized that peripheral blood mononuclear cells (PBMC) from SLE patients might respond abnormally to in vitro stimulation with CpG oligodeoxynucleotides (ODN).

Two different types of synthetic ODN containing unmethylated CpG ODN have been shown to reproduce the immunostimulatory properties of bacterial DNA on PBMC from normal healthy individuals [5]. K-type ODN have phosphorothioate backbones containing multiple TCGTT or TCGTA motifs. These ODN trigger B-cell proliferation and the secretion of IL-6, IL-10 and IgM. By comparison, D-type ODN have a mixed phosphodiester–phosphorothioate backbone, a single purine (Pu) pyrimidine (Py) CG PuPy motif flanked by self-complementary bases, and a 3' poly-G tail. D ODN primarily stimulate human dendritic and NK cells to produce interferon-{alpha} and -{gamma}, while increasing surface expression of MHC class II and various co-stimulatory molecules on monocytes and dendritic cells [5].

This study evaluated the in vitro response of PBMC from SLE patients to these two types of CpG ODN. In comparing the response of PBMC from SLE patients with those from healthy controls, we found that monocytes, dendritic cells and NK cells from SLE patients hypo-responded to CpG ODN, whereas B cells responded normally. The implications of these findings are discussed.


    Patients and methods
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 References
 
Patients
PBMC were obtained from normal controls through the NIH Department of Transfusion Medicine, and from SLE patients being treated in the out-patient clinic of the National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS) after Institutional Review Board approval and informed consent. We chose normal healthy volunteers as an appropriate control for this study, since preliminary experiments showed that PBMC from patients with rheumatoid arthritis (n=5) and Sjögren's syndrome (n=5) did not differ in their response to CpG ODN compared with normal healthy controls (data not shown).

Patients were diagnosed with SLE using established criteria [14, 15]. PBMC from a first set of 16 patients were used to assess IgM and cytokine secretion and proliferation induced by CpG ODN. The average Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) of these patients was 9.7 (range 0–23). Ten of these 16 patients were receiving hydroxychloroquine (200 mg twice daily) and 14 of 16 were receiving prednisone with an average dose of 16.5±8.5 mg per day (Table 1Go). Eight of 16 patients had also received other immunosuppressive drugs within the past 2 months, including methotrexate (n=2), azathioprine (n=1), cyclosporin (n=2), mycophenolate (n=1) or cyclophosphamide (n=2). PBMC from a second set of patients with similar characteristics (n=8, average SLEDAI 8.8, range 2–16) and receiving hydroxychloroquine (n=5) and/or prednisone (n=5) were used for flow cytometry analysis. The baseline characteristics of both patient groups were comparable as shown in Table 1Go.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Clinical characteristics of the SLE patients studied

 

Mononuclear cell preparation
PBMC were separated by density gradient centrifugation over Ficoll-Hypaque as described [4]. Cells were washed three times and cultured in 96-well plates in RPMI 1640 supplemented with 10% fetal calf serum, 100 U/ml penicillin, 100 µg/ml streptomycin, 1.5 mM L-glutamine, 1 mM HEPES, 0.1 nM sodium pyruvate and 50 µM 2-mercaptoethanol in a 5% CO2 in air incubator at 37°C. PBMC were stimulated with 1–3 µM CpG ODN or with phytohemagglutinin (1 µg/ml, GIBCO, Grand Island, NY). The cells were incubated for 72 h at 4x105 cells/well to generate supernatants or 8x104 cells/well for proliferation assays. Cell viability after 72 h was >95% as assessed by trypan blue. The concentrations of ODN used (1 µM for K ODN, 3 µM for D ODN), as well as the incubation period were chosen from dose–response curves with PBMC from healthy donors [5].

Oligodeoxynucleotides
ODN were synthesized at the Center for Biologics Evaluation and Research Core Facility. All had less than <0.1 EU/ml endotoxin per mg of ODN as assessed by LAL-Assay (BioWhittaker, Walkersville, Maryland). PBMC were stimulated with the panel of D ODN (D19: GGTGCATCGATGCAGGGGGG, D29: GGTGCACCGGTGCAGGGGGG and D28: GGTGCGTCGATGCAGGGGGG) or K ODN (K3: ATCGACTCTCGAGCGTTCTC, K23: TCGAGCGTTCTC and K123:TCGTTCGTTCTC). CGs are underlined, bases in bold type are phosphorodiester and bases in normal type are phosphorothioate. Control ODN had the same size, backbone and flanking sequence of stimulatory ODN, but lacked the active CpG dinucleotide (CG was switched to GC or TG).

Cytokine and Ig levels
Cytokine and Ig levels in culture supernatants were evaluated by enzyme-linked immmunosorbent assay (ELISA) as previously described [5]. Briefly, Immunolon 2 microtitre plates (Dynex Inc. Chantilly, VA) were coated with monoclonal antibodies to IL-6 (R&D, Minneapolis, Minnesota), interferon-{gamma} (Endogen, Woburn, Maine), IL-10 (Endogen, Woburn, Maine), interferon-{alpha} (PBL-Biomedical Laboratory, New Brunswick, New Jersey) or human Ig (Serotec, Oxford, England) and blocked with phosphate buffered saline/bovine serum albumin (PBS-BSA). Cytokine and Ig levels in culture supernatants were detected colorimetrically using biotin-labelled antibodies to IL-6 (Biosource, Camarillo, California), interferon-{gamma}, IL-10, interferon-{alpha} or IgM (Boehringer, Mannheim, Germany) followed by phosphatase-conjugated avidin and a phosphatase-specific colorimetric substrate (Pierce, Rockford, Illinois). Standard curves were generated using recombinant cytokine or purified IgM. All assays were performed in duplicate or triplicate and the mean±S.D. of the log-normalized data from all three D ODN and K ODN determined. The detection limits of the assays were: 5 pg/ml for interferon-{gamma} and IL-10, 20 pg/ml for IL-6 and 50 U/ml for interferon-{alpha}. When cytokine or Ig levels were below assay sensitivity, the lower limit of detection was used to calculate the stimulation indices. Stimulation indices were calculated by the formula: (stimulated cells – background)/(unstimulated cells – background).

Cell proliferation
A total of 8x104 cells were stimulated for 68 h with 1–3 µM CpG or control ODN, then pulsed with 1 µCi of [3H]-thymidine and harvested 4 h later.

Flow cytometry
PBMC were stimulated for 24 h with 3 µM D, K or control ODN. Cells were then harvested, fixed (Fix&Perm, Caltag, Burlingame, California), washed and stained with phycoerithrin-labelled anti-CD19 or anti-CD11c, cytochrome-labelled anti-CD40, and fluoroscein isothiocyanate (FITC)-labelled anti-HLA-DR (Pharmingen, San Diego, California). A total of 20 000 events were analysed per sample using a FACScan flow cytometer (Becton Dickinson, San Jose, California) and CellQuest software.

Toll-like receptor 9 (TLR-9) reverse transcription polymerase chain reaction (RT-PCR)
Total RNA from human PBMC was extracted with TRIzol (Gibco BRL, Gaithersburg, MD) according to the manufacturer's protocol: 5 µg of total RNA was reverse-transcribed using Superscript-II (Gibco BRL, Gaithersburg, MD) in first strand buffer (50 mM Tris-HCl, pH 7.5; 75 mM KCl and 2.5 mM MgCl2), containing 25 µg/ml oligo-(dT)12–18, 2 mM dNTP and 10 mM DTT.

The reaction was conducted at 42°C for 1 h. One microlitre of each cDNA sample was subjected to PCR (94°C for 30 s, 62°C for 30 s, 72°C for 60 s) for 30 cycles followed by a 10 min extension at 72°C using Taq polymerase (Promega, Madison, WI) and 0.5 µM of the following primers: human TLR-9: CTTCGGGGGCAGCTGGAGGAGT and ACAGGCAGGCAGAGGTGAGGTGAGT (483 bp); and human GAPDH: ACCACCATGGAGAAGGCTGG and CTCAGTGTAGCCCAGGATGC (527 bp).

Statistical analysis
The data were not normally distributed and therefore non-parametric two-tailed tests were used. Differences between lupus and control PBMC were evaluated using the Mann–Whitney U-test. Differences in their response to medium, D, K and control ODN were evaluated using non-parametric ANOVA (Kruskal–Wallis with Dunnett's post-test comparisons method). Correlations between ODN responsiveness, disease activity (SLEDAI) and patient treatment were analysed using the Spearman correlation. For all tests P<0.05 was considered significant in a two-tailed comparison.


    Results
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 References
 
CpG-induced activation of monocytes and dendritic cells
PBMC from 16 SLE patients and 16 healthy controls were stimulated in vitro with D, K or control ODN for 72 h as reported previously [5]. PBMC from healthy donors responded to D ODN with a 30-fold increase in interferon-{alpha} production relative to unstimulated PBMC (Fig. 1Go). In comparison, the magnitude of the response from PBMC from SLE patients to D ODN was only 4-fold when compared with unstimulated ones (P<0.05, Fig. 1AGo). Similarly, both K and D elicited a significant increase (16- and 9-fold, respectively, compared with unstimulated PBMC) in IL-6 production by PBMC of healthy controls, but a weaker (3-fold) response by PBMC from SLE patients (P<0.05, Fig. 1BGo). These results indicated that PBMC from SLE patients were hypo-responsive to both D and K ODN.



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 1. Response of PBMC from SLE patients (n=16, filled bars) and healthy volunteers (n=16, open bars) after stimulation with D ODN (D19: GGTGCATCGATGCAGGGGGG, D29: GGTGCACCGGTGCAGGGGGG and D28: GGTGCGTCGATGCAGGGGGG) or K ODN (K3: ATCGACTCTCGAGCGTTCTC, K23: TCGAGCGTTCTC and K123: TCGTTCGTTCTC). CG dimers are underlined, bases in bold type are phosphorodiester and bases in normal type are phosphorothioate. Control ODN had the same size, backbone and flanking sequence of stimulatory ODN, but lacked the active CpG dinucleotide. Secretion of inteferon-{alpha} (A) and IL-6 (B) were assessed by ELISA. Mean±S.D. of log-normalized data are depicted. Statistical significance was tested by non-parametric ANOVA (Kruskal–Wallis with post-test comparisons using Dunnett's method). *P<0.05.

 
Since previous studies had shown that dendritic cells and monocytes were the main source of CpG-induced interferon-{alpha} and IL-6, respectively, we next assessed the up-regulation of co-stimulatory markers on these cells. PBMC from normal controls showed a 6-fold increase in CD40 expression on CD11c+ dendritic cells and monocytes upon stimulation with D ODN, whereas only a 2-fold increase was evident on the PBMC from SLE patients (P<0.05, Fig. 2A and CGo). Up-regulation of HLA-DR was also decreased, although the magnitude of this effect did not reach statistical significance (P=0.09, Fig. 2B and CGo).



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 2. CpG ODN-induced up-regulation of co-stimulatory molecules on monocytes and dendritic cells. Freshly isolated PBMC from eight SLE patients (filled bars) and eight healthy controls (open bars) were stimulated with D, K or control ODN for 24 h. Cell surface expression of CD40 (A) and HLA-DR (B) on CD11c+ cells was assessed by flow cytometry. Data are depicted as mean±S.E.M. *P<0.05. (C) Examples of up-regulation of CD40 and HLA-DR on PBMC from a normal volunteer and an SLE patient upon stimulation with D ODN. Shaded area depicts unstimulated cells, dotted line represents staining after incubation with control ODN, and full line shows staining after stimulation with CpG ODN type D.

 
D ODN stimulate the production of interferon-{gamma}, primarily from NK cells. This activity is partially dependent on the secretion of interferon-{alpha} by dendritic cells [16, 17]. As shown in Fig. 3Go, SLE PBMC stimulated with D ODN produced significantly less interferon-{gamma} than those from controls (18 vs 113 pg/ml, P<0.05).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 3. Secretion of interferon-{gamma} by PBMC from 16 SLE patients (filled bars) and 16 healthy volunteers (open bars) after 72 h in vitro stimulation with ODN (see Fig. 1Go). Bars represent Mean±S.D. of log-normalized data. *P<0.05.

 
It is well known that ODN with phosphorothioate backbones stimulate immune cells in a CpG motif-independent manner. As shown in Figs 1 and 3GoGo, the reduced response of PBMC from SLE patients was not limited to CpG-mediated stimulation since the response to control ODN that lacked the CpG motif tended to be reduced when compared with healthy controls. However, the reduced response of monocytes and dendritic cells from SLE patients to CpG ODN did not reflect an inability of the cells to become activated, since the magnitude of their response to PHA was not statistically different from that of controls (Figs 1, 3 and 4GoGoGo). Moreover, the relative amount of interferon-{gamma} and IL-6 secreted by lupus PBMC stimulated with CpG ODN was significantly less than that of similarly treated control PBMC when calculated as a percentage of the PHA-induced response (P<0.05, data not shown).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4. Secretion of IgM (A) and IL-10 (B) and cellular proliferation (C) by PBMC from SLE patients (n=16, filled bars) and healthy volunteers (n=16, open bars) after stimulation with ODN. Mean±S.D. of log-normalized data are depicted.

 

Effect of CpG ODN on B cells from SLE patients
K ODN trigger B cells from healthy subjects to proliferate, secrete IgM and IL-10, and up-regulate cell surface expression of HLA-DR and co-stimulatory molecules (such as CD40) [18]. We next assessed whether the magnitude of the B-cell response to CpG ODN in PBMC from SLE patients was altered. Under optimal stimulatory conditions, no significant difference in the reactivity of lupus compared with normal B cells was observed. K ODN induced a 43-fold increase in IgM production by normal PBMC, and an equivalent 36-fold increase by lupus PBMC (Fig. 4AGo). The increase in IL-10 production was 3.6-fold in controls and 3.7-fold in SLE PBMC (Fig. 4BGo). Although the proliferative response of normal PBMC triggered by K ODN exceeded that of SLE cells (17-fold vs 11-fold), this difference was not statistically significant (Fig. 4GoC).

Further evidence that the response of lupus B cells to CpG stimulation was comparable with that of healthy subjects derived from phenotypic studies of activation marker expression. Consistent with previous reports, K ODN induced a 1.8-fold increase in HLA-DR expression on CD19+ cells. That increase was comparable to the 1.6-fold increase in HLA-DR expression on B cells from SLE patients (data not shown). Similarly, K ODN triggered a 4-fold increase in CD40 expression on normal B cells and a 3.7-fold increase on SLE B cells. These findings suggest that B cells from lupus patients conserve their ability to respond to CpG DNA.

TLR-9 mRNA expression
CpG ODN-mediated cell activation is mediated by TLR-9 expressed by B cells and plasmacytoid dendritic cells (pDC) [19]. To assess whether the reduction in cellular responsiveness to CpG ODN stimulation was due to a reduction in TLR-9 expression, RT-PCR was performed on PBMC from three SLE patients. As shown in Fig. 5Go, their expression levels were similar to those found on PBMC from healthy subjects. This demonstrates that the reduction in the magnitude of the response to CpG ODN is not due to a systemic defect in TLR-9 expression.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 5. Expression of TLR-9 mRNA in PBMC from three SLE patients and a normal control. TLR-9 mRNA expression was amplified by RT-PCR as described in the methods section. GAPDH expression served as a control.

 


    Discussion
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 References
 
CpG DNA stimulates monocytes, dendritic cells, B lymphocytes and NK cells to proliferate, mature and secrete a variety of cytokines, chemokines and/or Ig. Recent findings indicate SLE sera contains high levels of CpG DNA, and that this may contribute to the initiation and/or perpetuation of their disease [8]. This study shows that the response of PBMC from SLE patients to CpG ODN is abnormal. The activation of monocytes and dendritic cells by D and K ODN was impaired, as shown by decreased up-regulation of CD40 on their cell surface and reduced IL-6 and interferon-{alpha} secretion. Similarly, the interferon-{gamma} response was significantly reduced when compared with control PBMC. In contrast, the secretion of IgM and IL-10 by B cells was comparable with that of healthy controls. Together these data suggest that specific cell types in SLE patients are hypo-responsive to CpG ODN.

Bacterial DNA expresses CpG motifs that are recognized as a ‘pathogen-associated molecular pattern’ (PAMP) by the innate immune system. This recognition is mediated by TLR-9, and initiates a rapid inflammatory response [19]. Studies indicate that the innate immune response of SLE patients can be defective [20]. Scheinecker et al. [1] found a lower frequency of dendritic cells in PBMC from SLE patients compared with healthy controls. Moreover, dendritic cells in peripheral blood have reduced expression of CD40 and HLA-DR and reduced T-cell stimulatory capacity in mixed lymphocyte reactions. In vitro, monocytes from SLE patients show evidence of diminished phagocytic capacity [21] and impaired maturation into dendritic cells with low expression of CD40 and HLA-DR on their cell surface when cultured with granulocyte–macrophage colony-stimulating factor (GM-CSF) and IL-4 [2].

Despite the presence of CpG-rich DNA–anti-DNA immune complexes that elicit the secretion of interferon-{alpha} by dendritic cells from normal donors, recent studies document that the number of interferon-{alpha}-producing plasmacytoid dendritic cells in the peripheral blood is reduced in SLE patients [22, 23]. The current study extends these findings by showing a reduced response of monocytes and dendritic cells from SLE patients to activation by CpG ODN.

The maturation and activation of dendritic cells and NK cells is intimately integrated. Both the up-regulation of CD40 on the cell surface of dendritic cells and their secretion of interferon-{alpha} promote NK cell activation and the secretion of interferon-{gamma}. Conversely, activated NK cells contribute to the maturation of dendritic cells [24]. Previous studies have shown that in SLE patients, the number and lytic ability of NK cells in peripheral blood are reduced compared with NK cells from healthy controls [3, 20, 25, 26]. In addition, the number of PBMC secreting interferon-{gamma} in the absence of stimulation is reduced in these patients [4, 27]. The current results extend those findings by showing that the interferon-{gamma} production by SLE PBMC in response to CpG ODN stimulation is diminished. This suggests that the response of NK cells may be impaired, since they serve as a major source of interferon-{gamma} [5]. The reduced ability of NK cells to secrete interferon-{gamma} in response to CpG ODN is most likely secondary to a reduction in CD40 expression or interferon-{alpha} secretion by plasmacytoid dendritic cells [19].

The response of SLE monocytes, dendritic cells and NK cells to CpG ODN did not correlate with medication or disease activity as measured by the SLEDAI. This lack of correlation might be due to small sample size, since this study was not designed to detect such a correlation. However, reduced responses to CpG stimulation were also seen in patients whose disease was stable and in remission, suggesting that the abnormal response to CpG-induced immune activation is a sign of immunopathology in SLE that is independent from disease activity.

It is unclear whether the abnormal response of monocytes, dendritic cells and NK cells from lupus patients to CpG ODN reflects intrinsic cellular abnormalities, acclimatization to chronic exposure to stimulatory DNA in vivo or homeostatic efforts to reduce responsiveness to external stimuli. A systemic abnormality in CpG ODN recognition does not appear to be involved since B cells from SLE patients retain their responsiveness to CpG ODN (as measured by proliferation, up-regulation of CD40 and secretion of IgM and IL-10). Furthermore, as shown in Fig. 5Go, the expression of TLR-9 on PBMC from SLE patients is comparable with that of healthy controls. However, since the TLR-9 expression was studied on PBMC (where B cells outnumber pDC), we cannot exclude the possibility of an expression defect in a subpopulation of cells.

Regardless of the mechanism, the inability of dendritic cells to respond normally to CpG DNA may contribute to the unbalanced cytokine milieu (reduced interferon-{gamma} and an increased ratio of IL-10:interferon-{gamma}-secreting cells) described in these patients [4, 2729]. Thus, efforts to identify the abnormalities responsible for defective CpG responsiveness of SLE PBMC may shed light on the aetiopathogenesis of this disease.


    Acknowledgments
 
We wish to thank Dr S. Leitman-Klinman and the staff of the Blood Bank at the National Institutes of Health for collecting the blood samples from healthy volunteers and Mr D. Parking at NIAMS for collecting the blood samples from SLE patients. The assertions herein are the private ones of the authors and are not to be construed as official or as reflecting the views of the Food and Drug Administration.

This work was supported by an educational grant of the II. Medical Clinic, University of Kiel, Germany in part by an appointment to the Research Participation Program at CBER administered by the Oak Ridge Institute for Science and Education.


    Notes
 
Correspondence to: D. M. Klinman, Section of Retroviral Research, Center for Biologics Evaluation and Research (CBER), Food and Drug Administration, Bldg 29A, Room 3D10, Bethesda, Maryland 20892, USA. E-mail: klinman{at}cber.fda.gov Back


    References
 Top
 Abstract
 Introduction
 Patients and methods
 Results
 Discussion
 References
 

  1. Scheinecker C, Zwoelfer B, Koeller M, Maenner G, Smolen JS. Alterations of dendritic cells in systemic lupus erythematosus. Arthritis Rheum 2001;44:856–65.[CrossRef][Web of Science][Medline]
  2. Steinbach F, Henke F, Krause B, Thiele B, Burmester GR, Hiepe F. Monocytes from systemic lupus erythematosus patients are severely altered in phenotype and lineage flexibility. Ann Rheum Dis 2000;59:283–8.[Abstract/Free Full Text]
  3. Yabuhara A, Yang FC, Nakazawa T et al. A killing defect of natural killer cells as an underlying immunologic abnormality in childhood systemic lupus erythematosus. J Rheumatol 1996;23:171–7.[Medline]
  4. Hagiwara E, Gourley MF, Lee S, Klinman DK. Disease severity in patients with systemic lupus erythematosus correlates with an increased ratio of interleukin-10:interferon-{gamma}-secreting cells in the peripheral blood. Arthritis Rheum 1996;39:379–85.[Web of Science][Medline]
  5. Verthelyi D, Ishii KJ, Gursel M, Fumihiko T, Klinman DK. Human peripheral blood cells differentially recognize and respond to two distinct CpG motifs. J Immunol 2001;166:2372–7.[Abstract/Free Full Text]
  6. Richardson B, Scheinbart L, Strahler J, Gross L, Hanash S, Johnson M. Evidence for impaired T cell DNA methylation in systemic lupus erythematosus and rheumatoid arthritis. Arthritis Rheum 1990;33:1665–73.[Web of Science][Medline]
  7. Yung RL, Richardson BC. Role of T cell DNA methylation in lupus syndromes. Lupus 1994;3:487–91.[Abstract/Free Full Text]
  8. Sato Y, Miyata M, Nishimaki T, Kochi H, Kasukawa R. CpG motif-containing DNA fragments from sera of patients with systemic lupus erythematosus proliferate mononuclear cells in vitro. J Rheumatol 1999;26:294–301.[Web of Science][Medline]
  9. Napirei M, Karsunky H, Zevnik B, Stephan H, Mannherz HG, Moeroey T. Features of systemic lupus erythematosus in Dnase1-deficient mice. Nat Genet 2000;25:177–81.[CrossRef][Web of Science][Medline]
  10. Walport MJ. Lupus, DNase and defective disposal of cellular debris. Nat Genet 2000;25:135–6.[CrossRef][Web of Science][Medline]
  11. Gilkeson GS, Grudier JP, Karounos DG, Pisetsky DS. Induction of anti-double stranded DNA antibodies in normal mice by immunization with bacterial DNA. J Immunol 1989;142:1482–6.[Abstract]
  12. Pisetsky DS, Wenk KS, Reich CF III. The role of cpg sequences in the induction of anti-DNA antibodies. Clin Immunol 2001;100:157–63.[CrossRef][Web of Science][Medline]
  13. Pisetsky D, Drayton D, Wu ZQ. Specificity of antibodies to bacterial DNA in the sera of healthy human subjects and patients with systemic lupus erythematosus. J Rheumatol 1999;26:1934–8.[Medline]
  14. Hochberg MC. Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1997;40:1725.[Web of Science][Medline]
  15. Tan EM, Cohen AS, Fries JF, Masi AT, Mcshane DJ, Rothfield NF. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1982;25:1271–7.[Web of Science][Medline]
  16. Krieg AM. Now I know my CpGs. Trends Microbiol 2001;9:249–52.[CrossRef][Medline]
  17. Krug A, Rothenfusser S, Hornung V et al. Identification of CpG oligonucleotide sequences with high induction of IFN-{alpha}/ß in plasmacytoid dendritic cells. Eur J Immunol 2001;31:2154–63.[CrossRef][Web of Science][Medline]
  18. Decker T, Schneller F, Sparwasser T et al. Immunostimulatory CpG-oligonucleotides cause proliferation, cytokine production, and an immunogenic phenotype in chronic lymphocytic leukemia B cells. Blood 2000;95:999–1006.[Abstract/Free Full Text]
  19. Hornung V, Rothenfusser S, Britsch S et al. Quantitative expression of toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J Immunol 2002;168:4531–7.[Abstract/Free Full Text]
  20. Riccieri V, Spadaro A, Parisi G et al. Down-regulation of natural killer cells and of {gamma}/{delta} T cells in systemic lupus erythematosus. Does it correlate to autoimmunity and to laboratory indices of disease activity? Lupus 2000;9:333–7.[Abstract/Free Full Text]
  21. de la Fuente H, Richaud-Patin Y, Jakez-Ocampo J, Gonzalez-Amaro R, Llorente L. Innate immune mechanisms in the pathogenesis of systemic lupus erythematosus (SLE). Immunol Lett 2001;77:175–80.[CrossRef][Medline]
  22. Vallin H. Anti-double-stranded DNA antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous IFN-{alpha} inducer in systemic lupus erythematosus. J Immunol 1999;163:6306–13.[Abstract/Free Full Text]
  23. Blanco P, Palucka AK, Gill M, Pascual V, Banchereau J. Induction of dendritic cell differentiation by IFN-{alpha} in systemic lupus erythematosus. Science 2001;294:1540–3.[Abstract/Free Full Text]
  24. Piccioli D, Sbrana S, Melandri E, Valiante NM. Contact-dependent stimulation and inhibition of dendritic cells by natural killer cells. J Exp Med 2002;195:335–41.[Abstract/Free Full Text]
  25. Erkeller-Yuksel FM, Lydyard PM, Isenberg DA. Lack of NK cells in lupus patients with renal involvement. Lupus 1997;6:708–12.[Abstract/Free Full Text]
  26. Stohl W, Elliott JE, Hamilton AS, Deapen DM, Mack TM, Horwitz DA. Impaired recovery and cytolytic function of CD56+ T and non-T cells in systemic lupus erythematosus following in vitro polyclonal T cell stimulation. Studies in unselected patients and monozygotic disease-discordant twins. Arthritis Rheum 1996;39:1840–51.[Web of Science][Medline]
  27. Verthelyi D, Petri M, Ylamus M, Klinman DM. Disassociation of sex hormone levels and cytokine production in SLE patients. Lupus 2001;10:352–8.[Abstract/Free Full Text]
  28. Hagiwara E, Abbasi F, Mor G, Ishigatsubo Y, Klinman DM. Phenotype and frequency of cells secreting IL-2, IL-4, IL-6, IL-10, IFN{gamma} and TNF{alpha} in human peripheral blood. Cytokine 1995;7:815–22.[CrossRef][Web of Science][Medline]
  29. Verthelyi D, Klinman DM. Sex hormone levels correlate with the activity of cytokine-secreting cells in vivo. Immunology 2000;100:384–90.[CrossRef][Web of Science][Medline]
Submitted 10 May 2002; Accepted 6 November 2002


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
LupusHome page
K Hasegawa and T Hayashi
Synthetic CpG oligodeoxynucleotides accelerate the development of lupus nephritis during preactive phase in NZB xNZWF1 mice
Lupus, November 1, 2003; 12(11): 838 - 845.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
42/4/563    most recent
keg191v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (6)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Zeuner, R. A.
Right arrow Articles by Verthelyi, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeuner, R. A.
Right arrow Articles by Verthelyi, D.
Related Collections
Right arrow Systemic Lupus Erythematosus and Autoimmunity
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?