Rheumatology Advance Access originally published online on February 17, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Rheumatology 2004; 43: 569-573
Rheumatology Vol. 43 No. 5 (c) British Society for Rheumatology 2004; all rights reserved
Basic Science |
Up-regulation of XCR1 expression in rheumatoid joints
Section of Rheumatology and Section of Allergy and Immunology, Department of Internal Medicine, College of Medicine, National Cheng Kung University, Tainan; Taiwan and 1Branch of Molecular Biology, TaiGen Biotechnology, Taipei, Taiwan.
Correspondence to: C.-R. Wang, Section of Rheumatology and Section of Allergy and Immunology, Department of Internal Medicine, College of Medicine, National Cheng Kung University, Tainan, Taiwan. E-mail: wangcr{at}mail.ncku.edu.tw
| Abstract |
|---|
|
|
|---|
Objectives. Chemokine receptor-positive cells play a crucial role in controlling synovitis in rheumatoid arthritis (RA). We studied 16 chemokine receptors of the CC, CXC, CX3C and C families by analysing venous blood and synovial fluid samples and synovial tissues from RA patients.
Methods. Mononuclear cells (MNCs) in paired synovial fluid and venous blood samples from 7 RA patients were studied for the expression of CCR1 to 9, CXCR1 to 5, CX3CR1 and XCR1 by quantitative reverse transcription polymerase chain reaction (RT-PCR). Expression of chemokine receptors on synovial tissues from 9 RA patients were examined by in situ hybridization. Levels of chemokines were measured by enzyme-linked immunosorbant assay.
Results. Higher expression levels of XCR1 and CCR5 in MNCs from synovial fluid, as compared with those from venous blood, were consistently demonstrated in all RA patients (P<0.01). Through in situ hybridization, XCR1 expression was detected in infiltrating MNCs and synoviocytes in synovial tissues. Levels of lymphotactin, the ligand of XCR1, were significantly higher in the joint fluid than those in the paired serum samples (P<0.01).
Conclusions. We found an up-regulation of XCR1 expression in MNCs from the rheumatoid joint, and detected XCR1 expression in infiltrating MNCs in synovial tissues, as well as increased lymphotactin levels in synovial fluid. XCR1-positive cells may play a role in rheumatoid joints.
KEY WORDS: XCR1, Chemokine receptors, Lymphotactin, Chemokines, Rheumatoid arthritis.
| Introduction |
|---|
|
|
|---|
The migration of leucocytes from the blood stream into the inflammation sites is a dynamic process consisting of multiple steps involving adhesion molecules and chemotactic factors. Chemokines regulate the traffic of leucocytes by inducing cell motility and by activating adhesion molecules [1]. Chemokine receptors allow leucocytes to sense chemokine gradients, thereby directing these cells into tissue compartments [2]. As a result, the interaction of chemokines and chemokine receptors plays an important role in regulating leucocyte traffic within the immune system. Chemokines have a role to play in joint inflammation, not only by inducing leucocyte chemotaxis, but also by activating lymphocytes and stimulating angiogenesis [3, 4]. The synovial fluid and synovial tissues of rheumatoid arthritis (RA) patients contain some chemokines of the CC family, including monocyte chemoattractant protein-1, macrophage inflammatory protein-1
(MIP-1
), regulated upon activation normal T-expressed and secreted, and MIP-3
[3, 5]. They also contain chemokines in the CXC family such as IL-8, epithelial neutrophil-activating protein-78, growth-related gene product-
, connective tissue activating protein-III, IFN
inducible protein-10, platelet factor 4, monokine induced by IFN
, and stromal cell-derived factor-1 [3]. Fractalkine, a member of the CX3C family, has been identified in rheumatoid joints [6]. Recently, the expression of lymphotactin, a chemokine in the C family, has been demonstrated in the synovium of RA patients [7]. Since the migration of leucocytes is directed by interaction of chemokines with their receptors, the regulation of chemokine receptor expression has a pivotal role in the control of rheumatoid synovitis. Chemokine receptors have been found to be up-regulated in rheumatoid joints [5, 8, 9]. Current studies have suggested CCR1, CCR4, CCR5, CXCR3, CXCR4 and CX3CR1 are critical chemokine receptors in RA [810]. The relative contribution made by individual chemokine receptors to the progression of synovitis in RA is not fully known.
RA is an autoimmune disease characterized by the accumulation of activated mononuclear cells (MNCs) in the joint compartment and by the involvement of T helper 1 (Th1)-mediated immune responses in the pathogenesis [11]. In collagen-induced arthritis models, Th1 cells play a pro-inflammatory role, while T helper 2 (Th2) cells appear to have an anti-inflammatory effect [12, 13]. In order to evaluate the status of chemokine receptor expression in RA patients, we performed a quantitative reverse transcription polymerase chain reaction (RT-PCR) to examine the expression of 16 chemokine receptors in the CC, CXC, CX3C and C families. MNCs from paired synovial fluid and blood samples were studied for expression of CCR1 to 9, CXCR1 to 5, CX3CR1 and XCR1. Higher expression levels of XCR1 and CCR5 in synovial fluid as compared with those in paired blood samples were consistently demonstrated in all RA patients. We applied in situ hybridization to examine the expression of XCR1 in rheumatoid synovium and enzyme-linked immunosorbant assay (ELISA) in order to measure the levels of lymphotactin, the ligand of XCR1, in the synovial fluid and the paired blood samples.
| Materials and methods |
|---|
|
|
|---|
Patients and samples
Paired venous blood and synovial fluid samples were taken simultaneously from 11 RA patients during December 2002 to September 2003. These patients visited the Rheumatological Clinics of the Internal Medicine Department of National Cheng Kung University Hospital, a medical centre in southern Taiwan. The diagnosis of RA was according to the 1987 revised criteria of the American College of Rheumatology [14]. Synovial tissues were obtained at surgery from 9 RA patients. The Ethics Committee of the National Cheng Kung University Hospital approved this study. Informed consent was obtained from all patients enrolled into the study. The quantitative RT-PCR of 16 chemokine receptors was successfully performed in 7 paired samples with at least 2 µg of ribonucleic acid (RNA) from each sample. Detailed clinical data for these patients are shown in Table 1.
|
Quantitative RT-PCR of chemokine receptors
Peripheral MNCs were purified from heparin-anticoagulated venous samples by Histopaque (Sigma Diagnostics, St Louis, MO) gradient centrifugation. Synovial fluid was incubated with hyaluronidase (Sigma) for 30 min at 37°C and then passed through a nylon mesh. After spinning down and suspending in RPMI-1640, MNCs were separated by the Histopaque gradient. Total RNA was extracted from these cells by RNeasy kits (QIAGEN, Valencia, CA). RNA was reverse-transcribed by Superscript II enzyme (GIBCO BRL, Gaithersburg, MD) with 0.5 µg oligo(dT)1216 (Amersham, Piscataway, NJ). The reaction mixture was incubated at 42°C for 50 min followed by incubation at 72°C for 15 min. The complementary deoxyribonucleic acid (cDNA) from each tissue sample was subjected to quantitative RT-PCR using specific primer pairs for chemokine receptors including CC subtypes CCR1, 2, 3, 4, 5, 6, 7, 8 and 9, CXC subtypes CXCR1, 2, 3, 4 and 5, CX3C subtype CX3CR1 and C subtype XCR1. The sequences for specific primer pairs for the 16 chemokine receptors are listed in Table 2. All PCR reactions were performed using the LightCycler-FastStart DNA Master SYBR Green I kit (Roche, Indianapolis, IN). For each sample, the expression level of target chemokine receptor and the housekeeping gene, GAPDH, were determined. The sequence for the GAPDH-specific primers were forward (5'-TGAGCTGAACGGGAAG-3') and reverse (5'-GTGTCGCTGTTGAAGT-3'). The ratio of chemokine receptor to GAPDH was calculated as the normalized value. Cycling conditions were as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles at 94°C for 5 s, 57°C for 5 s and 72°C for 15 s. Amplified cDNAs were detected by fluorescence intensity. The PCR products of chemokine receptors were selected for automated nucleotide sequence analysis (ABI Prism 377 DNA Sequencer; Perkin Elmer, Foster City, CA) to ensure the accuracy of measurement.
|
ELISA of lymphotactin
Synovial fluid samples were treated with hyaluronidase for 30 min at 37°C before measurements. Quantification of lymphotactin levels in serum and joint fluid samples were done by ELISA DuoSet kits (R&D System). The 96-well microtitre plates were pre-coated with a monoclonal mouse anti-human lymphotactin antibody. One hundred microlitres of the samples [diluted 1:10 in phosphate-buffered saline (PBS) with 10% fetal calf serum] and standards were applied to each well, and incubated for 2 h at room temperature. Plates were washed and further incubated with a biotinylated polyclonal goat anti-human lymphotactin antibody. The specifically bound antibody was detected by application of streptavidin-horseradish peroxidase. Peroxidase activity was visualized by the addition of tetramethylbenzidine substrate solution in H2O2. After 20 min of incubation, 2 N H2SO4 stop solution was added, and the plates were read at 450 nm by an ELISA reader. The lowest detection sensitivity was 62.5 pg/ml. MIP-1
was quantified by ELISA Quantikine kits (R&D System, Minneapolis, MN) as described previously [5].
In situ hybridization of XCR1
Synovial tissues were dissected and embedded in ornithine carbamyl transferase (OCT) (Miles, Elkhart, IN) immediately after surgery and tissue blocks were stored at 80°C before sectioning. Sequential frozen sections (10 µm) were prepared using Leica CM1900 and thaw-mounted onto gelatin-coated slides. The slides were fixed with 4% paraformaldehyde for 10 min followed by 15% sucrose and then air-dried overnight. Dried slides were covered with foil and stored at 80°C until hybridization. Tissue sections were stained with haematoxylin/eosin for the morphological examination. Digoxigenin (DIG)-labelled XCR1 RNA probes were prepared with PCR amplification followed by in vitro transcription. Briefly, the selected region of XCR1 was amplified with PCR reaction and checked by agarose electrophoresis. The 5' primer sequence of XCR1 is ATCCTGTTCTGCTACGTGGAGATC and the 3' primer sequence is GGTTAAAGCAGCAGTGGGAGAAGG. For synthesis of the antisense riboprobe, we used 5' primer and added 20 nucleotides of T3 RNA polymerase AATTAACCCTCACTAAAGGG in 3' primer to create the T3 3' primer AATTAACCCTCACTAAAGGGGGTTAAAGCAGCAGTGGGAGAAGG. For synthesis of the sense riboprobe, we used 3' primer and added 20 nucleotides of T7 RNA polymerase TAATACGACTCACTATAGGG in 5' primer to create the T7 5' primer TAATACGACTCACTATAGGGATCCTGTTCTGCTACGTGGAGATC. After the PCR reaction, the amplified DNA was then purified with phenolchloroform extraction and resuspended in DEPC water for storage at 20°C. RNA probes were then prepared using in vitro transcription, and the labelling efficiency was determined by a direct detection kit (Roche). Frozen sections were thawed and washed with 2x SSC, and then digested with proteinase K (1 µg/ml) for 30 min at 37°C followed by acetylation with 0.1 M triethanolamine-HCl. After pre-hybridization with hybridization buffer for 2 h at 46°C, sections were hybridized with 50 µl DIG-labelled antisense RNA probe (5 ng/µl) for 18 h at the same temperature (hybridization with sense probes was included as a negative control). Unhybridized single-stranded RNA was then digested with 10 µg/ml RNase A in 10 mM Tris-HCl pH 8.0, 0.5 M NaCl, 1 mM EDTA at 37°C for 30 min. After stringent washing with SSC, signals were detected using alkaline phosphatase-conjugated anti-DIG antibody (Roche), diluted 500-fold in 0.1 M Tris-HCl, 0.15 M NaCl, pH 8.0, and the substrate BCIP-NBT (Sigma). Sections were incubated with anti-DIG antibody at room temperature for 4 h and signals developed in BCIP-NBT at room temperature for 45 min to 1 h. After counterstaining with 1% methylgreen, sections were air-dried and mounted with Glycer-gel mounting medium (Dako, Carpinteria, CA). Signals were observed under microscopy (Olympus BX 40) and recorded using a digital camera (Olympus C-4040).
Statistical analysis
Statistical analyses were carried out using the Wilcoxon signed rank test for comparison of chemokine receptor levels between MNCs from synovial fluid and from peripheral blood, and for comparison of chemokine levels between the joint fluid and the serum samples.
| Results |
|---|
|
|
|---|
Table 3 shows the expression ratios of chemokine receptors mRNA from synovial fluid MNCs to those from peripheral blood MNCs. The results were consistent in XCR1 and CCR5 when comparing the expression levels of the joint fluid with those of the paired blood samples. Synovial MNCs had higher levels of XCR1 and CCR5 compared with those of peripheral MNCs (59.1 ± 32.1 vs 22.4 ± 9.8 and 94.1 ± 50.7 vs 30.2 ± 6.5, both P<0.01). Due to the low levels of XCR1 and CCR5 expression in the synovial MNCs, patient no. 5 had the lowest expression ratios.
|
To verify the expression of XCR1 in situ, the in situ hybridization was performed using synovial specimens from 9 RA patients. Figure 1A shows typical staining of XCR1 in synovial tissue from a RA patient. XCR1 expression was detected in both the infiltrating MNCs and the synoviocytes. The signal density in synoviocytes was stronger than that of the MNCs. Figure 1B shows a negative response from the same patient to the sense probe.
|
We also measured levels of lymphotactin, the ligand of XCR1, in these samples. High amounts of lymphotactin were detected in synovial fluid samples (4.64 ± 1.86 ng/ml, mean ± standard deviation, ranging from 2.29 to 7.69 ng/ml). Paired serum samples contained lower levels (1.55 ± 0.41 ng/ml, ranging from 1.10 to 2.47 ng/ml, P<0.01). In each patient, the lymphotactin level in joint fluid was consistently higher than that in the paired serum sample. For these paired samples, we also measured levels of MIP-1
, the ligand of CCR5, and obtained similar results as reported previously [5]. Elevated levels of MIP-1
were found in the joint fluid samples (2.59±1.10 ng/ml, ranging from 4.16 to 0.80 ng/ml). Paired serum samples had lower levels (0.50±0.18 ng/ml, ranging from 0.22 to 0.79 ng/ml, P<0.01). | Discussion |
|---|
|
|
|---|
XCR1, the former orphan receptor G protein-coupled receptor 5, is the only C family chemokine receptor that is specific for lymphotactin, also referred to as single cysteine motif-1 (SCM-1), or activation-induced, T-cell-derived and chemokine-related cytokine (ATAC) [15, 16]. Among human tissues, XCR1 is expressed in the spleen, the thymus and the placenta, and in peripheral blood leucocytes at a lower level [15]. It has been shown that T and B lymphocytes and neutrophils could express XCR1 receptors [17]. Recently, XCR1 expression has been detected in macrophages after exposure to IFN
[18]. Biological responses of XCR1-positive leucocytes remain to be determined; however, a potential role in anti-tumor immunity is suggested by the ability of infiltrating XCR1-positive T cells in repressing tumours engineered to express lymphotactin in vivo [19].
Lymphotactin is produced mainly by activated T cells and natural killer (NK) cells, and its biological functions as well as its pathological roles remain to be elucidated [7, 15, 16]. Lymphotactin has been reported to be induced by stimulation through T-cell receptors in Th1 cells, but not in Th2 cells, and co-secreted to a high degree with IFN
by activated Th1 cells [18, 20]. Lymphotactin is secreted by islet-specific Th1 cells in autoimmune diabetes, and is detected in MNCs of peripheral blood from patients with multiple sclerosis [21, 22]. Taken together, these data suggest that lymphotactin expression is an integral part of the differentiation programme for a functionally distinct Th1 subset, and lymphotactin plays a role in Th1-mediated diseases. However, the relative significance of its receptor XCR1 in the Th1-mediated immune responses remains unknown.
In our present study, higher amounts of lymphotactin were found in synovial fluid compared with those in paired serum samples. However, levels of lymphotactin were reported to be similar in sera and synovial fluids from RA patients by Blaschke et al [7]. One possible explanation for this discrepancy is that a monoclonal instead of a polyclonal anti-human lymphotactin antibody was used in the present study to coat the microtitre plates for sandwich ELISA, which may avoid non-specific binding and raise the specificity for measurements of lymphotactin. In addition, joint fluid and peripheral blood samples were not obtained simultaneously from the same patients in their study.
We examined the expression of 16 chemokine receptors in MNCs from paired synovial fluid and peripheral blood samples by quantitative RT-PCR. A consistent up-regulation of XCR1 and CCR5 in synovial MNCs from RA patients was demonstrated. The result for CCR5 was similar to those reported using a flow cytometry analysis by Mack et al [23]. Using in situ hybridization to verify the expression of XCR1-positive cells in rheumatoid synovium, we obtained a similar result as the study by Blaschke et al [7]. Both synoviocytes and infiltrating MNCs expressed XCR1. Expression levels of CCR5 and XCR1 were lowest in patient no. 5 who received etanecept, a soluble TNF-
receptor antagonist. The synovial microenvironment plays a role in the regulation of CCR5 expression in the rheumatoid joint [5]. It has been reported that stimulation with TNF-
will increase CCR5 expression on cultured chondrocytes [24]. CCR5 expression in rheumatoid joints might be down-regulated without the TNF-
stimulation. The mechanisms regulating XCR1 expression within the rheumatoid joint remain to be studied.
In conclusion, we found up-regulation of XCR1 expression in MNCs of the rheumatoid joint, and detected XCR1 expression in infiltrating MNCs in rheumatoid synovium, as well as increased lymphotactin levels in synovial fluid. XCR1-positive cells may play a role in rheumatoid joints, and there may be potential for the treatment for RA patients in therapeutic manipulation of XCR1.
The authors have declared no conflicts of interest.
| Acknowledgments |
|---|
This work was supported by grants NSC 892314-B-006-098 and 922314-B-006047 from the National Science Council, Taiwan. We thank Professor Chyun-Yu Yang, Chief of the Department of Orthopedics, College of Medicine, National Cheng Kung University, for providing synovial specimens from RA patients. We also thank Ms Li-Ling Fang and Ms Chiung-Ru Wu for technical assistance.
|
| References |
|---|
|
|
|---|
- Luster AD. The role of chemokines in linking innate and adaptive immunity. Curr Opin Immunol 2002;14:12935.[CrossRef][Web of Science][Medline]
- Zlotnik A, Rossi D. The biology of chemokines and their receptors. Annu Rev Immunol 2000;18:21742.[CrossRef][Web of Science][Medline]
- Szekanecz Z, Kim J, Koch AE. Chemokines and chemokine receptors in rheumatoid arthritis. Semin Immunol 2003;15:1521.[CrossRef][Medline]
- Silvestri T, Meliconi R, Pulsatelli L et al. Down-modulation of chemokine receptor cartilage expression in inflammatory arthritis. Rheumatology 2003;42:1418.
[Abstract/Free Full Text] - Wang CR, Liu MF. Regulation of CCR5 expression and MIP-1
production in CD4+ T cells from patients with rheumatoid arthritis. Clin Exp Immunol 2003;132:3718.[CrossRef][Web of Science][Medline]
- Blaschke S, Koziolek M, Schwarz A et al. Proinflammatory role of fractalkine (CX3CL1) in rheumatoid arthritis. J Rheumatol 2003;30:191827.
[Abstract/Free Full Text] - Blaschke S, Middel P, Dorner BG et al. Expression activation-induced, T cell-derived, and chemokine-related cytokine/lymphotactin and its functional role in rheumatoid arthritis. Arthritis Rheum 2003;48:185872.[CrossRef][Medline]
- Ruth JH, Rottman JB, Katschke KJ Jr et al. Selective lymphocyte chemokine receptor expression in the rheumatoid joint. Arthritis Rheum 2001;44:275060.[CrossRef][Web of Science][Medline]
- Nanki T, Hayashida K, El-Gabalawy HS et al. Stromal cell-derived factor-1-CXC chemokine receptor 4 interactions play a central role in CD4+ T cell accumulation in rheumatoid arthritis synovium. J Immunol 2000;165:65908.
[Abstract/Free Full Text] - Haringman JJ, Kraan MC, Smeets TJM, Zwinderman KH, Tak PP. Chemokine blockade and chronic inflammatory disease: proof of concept in patients with rheumatoid arthritis. Ann Rheum Dis 2003;62:71521.
[Abstract/Free Full Text] - Panayi GS. T cell-dependent pathways in rheumatoid arthritis. Curr Opin Rheumatol 1997;9:23640.[CrossRef][Medline]
- Mauri C, Williams RO, Walmsley M. Relation between Th1 and Th2 cytokine patterns and the arthritogenic response in collagen-induced arthritis. Eur J Immunol 1996;26:151118.[Web of Science][Medline]
- Wang CR, Liu MF, Chen PC, Yang CY, Wu CR. Involvement of CCR5+CD4+T cells in a murine model of collagen-induced arthritis. Arthritis Rheum 2002;46:S258.
- Arnett FC, Edworthy SM, Bloch DA et al. American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum 1988;31:31524.[Web of Science][Medline]
- Yoshida T, Imai T, Kakizaki M, Nishimura M, Takagi S, Yoshie O. Identification of single C motif-1/lymphotactin receptor XCR1. J Biol Chem 1998;273:165514.
[Abstract/Free Full Text] - Muller S, Dorner B, Korthauer U et al. Cloning of ATAC, an activation-induced, T cell-derived, and chemokine-related molecule exclusively expressed in CD8+ T lymphocytes. Eur J Immunol 1995;25:17448.[Medline]
- Huang H, Li F, Cairns CM, Gordon JR, Xiang J. Neutrophils and B cells express XCR1 receptor and chemotactically respond to lymphotactin. Biochem Biophys Res Commun 2001;281:37882.[CrossRef][Web of Science][Medline]
- Dorner BG, Scheffold A, Rolph MS et al. MIP-1alpha, MIP-1beta, RANTES and ATAC/lymphotactin function together with IFN-gamma as type 1 cytokines. Proc Natl Acad Sci USA 2002;99:61816.
[Abstract/Free Full Text] - Huang H, Li F, Gordon JR, Xiang J. Synergistic enhancement of antitumor immunity with adoptively transferred tumor-specific CD4+ and CD8+ T cells and intratumoral lymphotactin transgene expression. Cancer Res 2002;62:204351.
[Abstract/Free Full Text] - Zhang S, Lukacs NW, Lawless VA, Kunkel SL, Kaplan MH. Cutting edge: differential expression of chemokines in Th1 and Th2 cells is dependent on Stat6 but not Stat4. J Immunol 2000;165:1014.
[Abstract/Free Full Text] - Bradley LM, Asensio VC, Schioetz LK et al. Islet-specific Th1, but not Th2, cells secrete multiple chemokines and promote rapid induction of autoimmune diabetes. J Immunol 1999;162:251120.
[Abstract/Free Full Text] - Jalonen TO, Pulkkinen K, Ukkonen M, Saarela M, Elovaara I. Differential intracellular expression of CCR5 and chemokines in multiple sclerosis subtypes. J Neurol 2002;249:57683.[CrossRef][Web of Science][Medline]
- Mack M, Bruhl H, Gruber R et al. Predominance of mononuclear cells expressing the chemokine receptor CCR5 in synovial effusions of patients with different forms of arthritis. Arthritis Rheum 1999;42:9818.[CrossRef][Web of Science][Medline]
- Yuan GH, Masuko-Hongo K, Sakata M et al. The role of C-C chemokines and their receptors in osteoarthritis. Arthritis Rheum 2001;44:105670.[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
