Skip Navigation


Rheumatology Advance Access originally published online on October 13, 2006
Rheumatology 2007 46(4):590-596; doi:10.1093/rheumatology/kel348
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
46/4/590    most recent
kel348v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Di Genaro, M. S.
Right arrow Articles by de Guzmán, A. M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Di Genaro, M. S.
Right arrow Articles by de Guzmán, A. M. S.
Related Collections
Right arrow Spondylarthropathies
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2006. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Role of TNFRp55 in Yersinia enterocolitica O:3-induced arthritis: triggering bacterial antigens and articular immune response

M. S. Di Genaro, D. E. Cargnelutti, J. R. Eliçabe, M. G. Lacoste, S. Valdez1, N. Gómez and A. M. S. de Guzmán

Laboratory of Microbiology and Immunology, Faculty of Chemistry, Biochemistry and Pharmacy, National University of San Luis, 5700, San Luis and 1LARLAC (CONICET) Faculty of Medicine, National University of Mendoza, 5500, Mendoza, Argentina.

Correspondence to: M. S. Di Genaro, Laboratory of Microbiology and Immunology, Faculty of Chemistry, Biochemistry and Pharmacy, National University of San Luis, 5700, San Luis, Argentina. E-mail: sdigena{at}unsl.edu.ar


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Objectives. The pathogenesis of reactive arthritis (ReA), an aseptic synovitis that follows an extra-articular infection, is incompletely known. We studied the impact of tumour necrosis factor receptor (TNFR) p55 deficiency on the progression to ReA after oral Yersinia enterocolitica O:3 infection, the Yersinia antigens triggering articular inflammation and a possible articular TNFRp55-mediated mechanism that protects against ReA.

Methods. Wild-type C57BL/6 and TNFRp55–/– mice were orogastrically infected with Y. enterocolitica O:3 and monitored for survival and arthritis development. The bacterial load was determined in mesenteric lymph nodes (MLNs), the spleen and joints. Interferon (IFN)-{gamma}, TNF-{alpha} and IL-10 mRNA expression in MLN and joints were analysed by reverse transcription-polymerase chain reaction (RT-PCR). Articular antibodies to Yersinia antigens, TNF-{alpha} protein and nitric oxide (NO) levels were assessed. Acute arthritis was evaluated after joint injection of Yersinia antigens.

Results. The survival rate was 60% in TNFRp55–/– mice. They showed impaired bacterial clearance in MLN, the spleen and joints, and excessive mRNA expression of pro-inflammatory cytokines in MLN. Clinical and histological examinations revealed that TNFRp55–/– mice developed severe arthritis. Moreover, augmented articular outer membrane protein (OMP)-specific antibodies and TNF-{alpha} but impaired NO levels were detected in TNFRp55–/– mice. Synovial inflammatory response was detected by joint OMP injection.

Conclusions. TNFRp55-mediated immune mechanisms prevent ReA development after oral infection with Y. enterocolitica O:3. Yersinia OMPs are the relevant antigens triggering ReA. NO induction through TNFRp55 signalling could have a local antibacterial function to prevent ReA. This study could contribute to ReA-specific therapeutic studies.

KEY WORDS: Yersinia enterocolitica, Reactive arthritis, TNFRp55, Oral infection, Mice, Bacterial antigens, Nitric oxide


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Reactive arthritis (ReA) is an aseptic synovitis that follows an extra-articular infection. Yersinia enterocolitica, a Gram-negative bacterium, causes intestinal infection which could be complicated by ReA. Because the pathogenesis of ReA is incompletely understood, appropriate treatments are not available [1].

There is increasing evidence that TNF-{alpha} genotypes which seem to be associated with low TNF-{alpha} production are present at a higher percentage in ReA [2]. Moreover, aberrant TNF secretion has been recently reported in subjects with previous Yersinia-triggered ReA [3]. TNF mediates pleiotropic activities via two surface receptors, TNFRp55 (TNFR1, CD120a) and TNFRp75 (TNFRII, CD120b). TNFRp55 has been implicated in the majority of known TNF effects [4]. Although the critical role of TNFRp55 in Y. enterocolitica O:8 protection [5] and arthritis induction after intravenous infection [6] has been demonstrated, the impact of TNFRp55 deficiency on the Yersinia-induced ReA after an oral infection has not been explored. To investigate arthritis development after gastrointestinal infection could be important since a link between gut inflammation and arthritis has been frequently suggested [7]. In addition, the arthritogenicity of Y. enterocolitica serotype O:3, the most frequently occurring human arthritogenic serotype, has not been studied in TNFRp55–/– mice. Furthermore, since abnormality of TNF-{alpha} level has been detected in patients with ReA [3], the results presented here could be extrapolated to human ReA.

In the present work, we evaluated first the role of TNFRp55 at the onset and progression of ReA after oral infection with Y. enterocolitica O:3. Second, because bacterial products could contribute in the ReA induction [1], we analysed the relevant microbial antigens and bacterial-specific intra-articular antibodies in relation to ReA. Finally, since nitric oxide (NO) is not only an important inflammatory mediator of innate host defence [8] controlling bacterial infection but also causing tissue damage, we investigated the articular levels of nitrite in the mice to evaluate its beneficial or detrimental effects on Yersinia-induced ReA. This work may contribute to understand some aspects of the complex mechanisms that lead to ReA development and to design strategies for its specific therapeutic treatment.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Mice
We used TNFRp55–/–mice [5] on a C57BL/6 background and C57BL/6 wild-type mice. Mice were kept under specific pathogen-free conditions in positive-pressure cabinet (EHRET, Germany) and provided with sterile food and water ad libitum. Mice 6 to 8-weeks-old were used for the experiments. Three independent experiments were carried out with 4–9 mice per group. Ethical approval for this study was granted by the Ethical Committee of Medical Science Faculty of National University of Cuyo (Mendoza, Argentina).

Bacteria and infection
Strain MHC 700 of Y. enterocolitica O:3 (kindly provided by Dr Kapperud, Department of Bacteriology, Oslo, Norway) was used for infection. Bacteria were cultured as described earlier [5]. Mice were starved for 8 h, and 200 µl of 5% NaHCO3 in phosphate-buffered saline (PBS) was given prior to infection. Seven mice per group were infected orogastrically with a gastric tube, and 1–5 x 108 yersiniae in 200 µl were injected. The actual number of bacteria administrated was controlled for each experiment by plating serial dilutions of the inoculated suspension on Mueller–Hinton agar and counting the colony-forming units (CFUs) after incubation at 26°C for 48 h. In accordance with previous experiences, we selected three time points to study the mice: day 3, as early time of the infection to study the susceptibility of TNFRp55–/– mice to Y. enterocolitica serotype O:3 and to compare our results with other studies with serotype O:8 [5], and days 21 and 52, as late time of the infection to evaluate the bacterial clarification and ReA development. Thus, 3, 21 and 52 days after infection, mice were sacrificed and MLN, the spleen, and joints of each mouse were aseptically removed. Three uninfected mice per group were used as controls.

Bacteriological examination
The number of bacteria present in MLN and the spleen was determined by homogenization of these organs in PBS (pH 7.4), and plating of serial dilutions of the homogenates on Mueller–Hinton agar [9]. To determine bacterial numbers in the joints, ankles from each mouse were excised by removing the skin and cutting just above and below tibiotarsal joint and placed immediately in 1 ml of cold PBS. Joint extract was performed using a tissue homogenizer and plated on Mueller–Hinton agar. The detection limit was 25 CFU (log = 1.4) [9].

Assessment of arthritis
Mice were examined for visual appearance of arthritis in peripheral joints and the arthritis score was calculated as described earlier [10]. Clinical severity of arthritis was graded on a four-number scale for each paw: 0 normal joint; 1 slight inflammation and redness; 2 severe erythema and swelling affection of the entire paw, with inhibition of the use; and 3 deformed paw of joint, with ankylosis, joint rigidity and loss of function. The total score for clinical disease activity was based on all four paws, with a maximum score of 12/animal [10]. In addition, X-ray study of the limbs was performed.

Histological evaluation
At day 21 after infection, histological examination of joints was carried out after routine fixation, decalcification and paraffin embedding. Five-micrometre-thick sections were cut and stained with haematoxylin and eosin. Histopathological scoring was performed as described by Kyo et al. [1]. Ankles from mice were assigned inflammation scores of 0–5, where 0 = normal, 1 = minimal infiltration of inflammatory cells, 2 = mild infiltration, 3 = moderate infiltration, 4 = marked infiltration and 5 = severe infiltration. The same ankles were then given a score for cartilage/bone resorption, according to the following criteria: 0 = normal, 1 = minimal (small areas of resorption), 2 = mild (numerous areas of resorption), 3 = moderate (obvious resorption of trabecular and cortical bone, without full-thickness defects in the cortex; loss of some trabeculae), 4 = marked (full-thickness defects in the cortical bone and marked trabecular loss, without distortion of the profile of the remaining cortical surface) and 5 = severe (full-thickness defects in the cortical bone and marked trabecular bone loss, with distortion of the profile of the remaining cortical surface). The total score was defined as the sum of the score for inflammation and the score for cartilage/bone destruction. Each slide was scored by two independent observers and the average score was used.

Investigation of bacterial antigens and antibodies in the joints
At 21 days after infection, joint extracts were prepared as described earlier and centrifugated at 2000 x g for 20 min at 4°C. The supernatants were then used for the detection of antibacterial antibodies. Antigen preparations of Y. enterocolitica O:3 were obtained. Whole bacteria disrupted by sonication (SON) were prepared from washed bacterium pellets [11]. Outer membrane proteins (OMP) and cytoplasmic (Cyt) proteins were prepared as described by Michiels et al. [11]. Yersinia outer proteins (Yops), which are released in the culture supernatant, were precipitated with trichloroacetic acid and prepared as described by Trcek et al. [12]. Lipopolyssacharide (LPS) was obtained as described earlier [13]. The levels of antibodies against the different Yersinia antigen preparations were studied by ELISA. A 96-well plate was precoated with 10 µg/ml of SON, OMP, Cyt, Yops or LPS. Joint extracts were assayed without dilution. This was followed by the addition of peroxidase-conjugated goat anti-mouse IgG, and the bound antibodies were revealed with H2O2 and O-phenylenediamine (Sigma). Joint extracts from uninfected mice were used as controls. In addition, the specificity of the intra-articular antibodies against Yersinia antigens was studied by dot blot. Similar protein concentration of the Yersinia antigens, obtained as described earlier, were seeded (2 µl) on nitrocellulose membrane. After blocking, the membrane was incubated with each clarified joint extract. Peroxidase-conjugated goat anti-mouse IgG (Sigma) was added. This was followed by the addition of the enzyme substrate (H2O2) and chromogen enzyme 4-choro-1-napthol. Moreover, antibody response to OMP was studied by western blot. OMPs were resolved in a SDS-polyacrylamide 10% gel and transferred to nitrocellulose (BioRad) membrane, which was incubated with the clarified joint extracts without dilution. Bound secondary antibody, peroxidase-conjugated goat anti-mouse IgG, was detected as described earlier for dot blot.

Acute arthritis induced by bacterial preparations
To study the antigens triggering arthritis in TNFRp55–/– mice, a model of acute ReA was carried out [1]. Uninfected TNFRp55–/– mice were intramusculary injected with 10 µg/ml of SON, and after 7 days they were challenged with an intra-articular injection of PBS (control), LPS, Cyt or OMP (10 µg/ml). Seven days later, histological studies of the joint were performed.

IFN-{gamma}, TNF-{alpha} and IL-10 mRNA levels in MLN and joints
At day 3 after infection, MLNs were excised and immediately frozen in liquid N2. Moreover, at day 21 after infection, ankle joints were excised, frozen, wrapped in aluminium foil and pulverized with a hammer [14]. The tissue was then placed immediately in 1 ml of TRIzol reagent (Invitrogen) and RNA extraction was performed as described by the manufacturer. RNA from 3 individual samples for each group was pooled for the analysis. Synthesis of cDNA was performed using 2 µg of total RNA, SuperScript II reverse transcriptase (Invitrogen) and oligo-dT primer (Invitrogen) [5]. Polymerase chain reaction (PCR) was performed on cDNA for a total of 25 (ß-actin), 30 (IFN-{gamma} and TNF-{alpha}) and 35 (IL-10) cycles at 94°C for 30 s, 65°C for 45 s and 72°C for 60 s. Reverse transcription (RT)-PCR products were visualized by agarose gel electrophoresis. Semiquantitative mRNA levels were determined by analysing the intensity of each band using the program ImageJ (Version 1.34s). Values were expressed in arbitrary units as the ratio of cytokine mRNA to the corresponding ß-actin mRNA level. The sequences of the sense and antisense primers used in this study are as follows (5' to 3'): ß-actin sense, TGGAATCCTGTGGCATCCATGAAAC; antisense, TAAAACGCAGCTCAGTAACAGTCCG (348 bp product); IFN-{gamma} sense, TGAACGCTACACACTGCATCTTGG; antisense, TGACTCC TTTTCCGCTTCCTGAG (460 bp product); TNF-{alpha} sense, GGCAGGT CTACT TTGGAGTCATTGC; antisense, ACATTCGAGGCTCCAGTGAATTCGG (307 bp product); IL-10 sense, ACCTGGTAGAAGTGA TGCCCCAGGCA; antisense, CTATGCAGTTGATGAAGAAGATGT CAAA (237 bp product).

Measurement of TNF-{alpha} protein and NO in the joint extracts
At day 21 after infection, levels of TNF-{alpha} in the joint extracts from 4 mice per group were quantified with an ELISA kit (ChemikineTM mouse TNF-{alpha} sandwich ELISA kit, Chemicon International) according to the manufacturer's instructions. NO production in the joint homogenates was measured using the Griess reagent [15]. Fifty microlitres of clarified homogenates were mixed in 96-well plates with 100 µl of 0.5% sulphanilamide dihydrochloride and 0.05% naphthylethylenediamide dihydrochloride in 2.5% phosphoric acid. A standard curve (1.9–500 µM) of NaNO2 in PBS was prepared and read together with the samples in a microplate reader (BioRad).

iNOS western blot analysis in the joints
The clarified joint extracts of day 21 were loaded at the same protein concentration on a SDS-polyacrylamide 12% gel. Resolved proteins were transferred to nitrocellulose membrane (BioRad). Antigen was detected with a rabbit polyclonal antibody against iNOS enzyme (Santa Cruz Biotechnology) in dilution 1:1000. After incubation with a peroxidase-conjugated goat anti-rabbit IgG secondary antibody, the colour was developed using Vectastain ABC kit (Vector Laboratories). Joint homogenates from uninfected mice were used as controls. Equal loading was confirmed by PonceauS staining of the membrane.

Statistical analysis
Differences between groups were tested for significance by Student's unpaired t-test, and among three or more groups by one-way ANOVA and Tukey–Kramer multiple comparisons test. A P value less than 0.05 was considered statistically significant. All experiments were repeated at least three times and revealed comparative results.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Effect of TNFRp55 deficiency on sensitivity to oral infection with Y. enterocolitica O:3
The survival was monitored for 2 months in Y. enterocolitica O:3-infected wild-type and TNFRp55–/– mice. The survival was 60% in TNFRp55–/– mice, whereas no mortality was observed in control mice (Fig. 1A). To determine whether TNFRp55 deficiency affected mucosal and systemic Yersinia clarification, we assessed the bacterial numbers in cultures of MLN, the spleen and joints on days 3, 21 and 52 after infection. At day 3, the bacterial loads in MLN and the spleen were significantly higher in TNFRp55–/– compared with C57BL/6 mice (P < 0.0006 and P < 0.04, respectively) (Fig. 1B). At this time of infection, no differences were detected in the numbers of bacteria in the joints between wild-type and TNFRp55–/– mice (Fig. 1B). At day 21, only 5 mice were still alive in the group of TNFRp55–/– mice. They showed significantly higher numbers of CFU in the spleen and the joint compared with wild-type mice (P < 0.03) (Fig. 1B). On day 52, the bacteria were mostly clarified from MLN, the spleen and joints of both groups of mice (Fig. 1B). To determine whether TNFRp55 deficiency affected mucosal cytokine expression, IFN-{gamma}, TNF-{alpha} and IL-10 mRNA were studied in MLN. After 3 days of infection, IFN-{gamma} and TNF-{alpha} mRNA in MLN were markedly up-regulated in TNFRp55–/– mice compared to those in control mice (Fig. 1C). Unlike that of pro-inflammatory cytokines, no different expression of IL-10 mRNA was detected (Fig. 1C).


Figure 1
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 1. Susceptibility of TNFRp55–/– mice after Y. enterocolitica O:3 infection. (A) survival curve of wild-type (n = 9) and TNFRp55–/– mice (n = 9). (B) Bacterial load in MLN, the spleen and joints after 3, 21 and 52 days of oral infection with Y. enterocolitica O:3. The results are the average of three independent experiments (7 mice per group). Each point on the scatter plot represents log CFU per organ from an individual mouse. Dotted line represents the detection limit (log CFU = 1.4). The median for each data set from mice that survived is indicated with a horizontal bar, and asterisks represent statistically significant. ns: not significant. (C) IFN-{gamma}, IL-10 and TNF-{alpha} mRNA expression in MLN of mice at day 3. Total RNA from MLN of 3 mice per group were pooled and analysed by RT-PCR. Relative mRNA levels are showed normalized with ß-actin.

 
Effect of TNFRp55 deficiency on clinical disease activity and joint histology
TNFRp55–/– mice exhibited macroscopic signs of severe and progressive arthritis with significantly higher clinical score compared with wild-type mice (Fig. 2A) from days 22 to 56 after infection (P < 0.05). High inflammation in the TNFRp55–/– joints was also observed by X-ray study (Fig. 2B). Moreover, extensively increased scores for inflammation and bone/cartilage degradation resulted when histopathological changes were analysed in the joints of TNFRp55–/– mice on the onset of ReA (day 21) (Fig. 2B). In these animals, we observed luminal disorganization of the synovial membrane, which was densely infiltrated with various types of leucocytes, sometimes concomitant with follicle formation (Fig. 2B). The articular cartilage and bone were degraded (total score 10–14). Proliferation of synovial lining cells was also detected (Fig. 2B). In contrast, neither clinical arthritis nor histological changes were observed in wild-type C57BL/6 mice during the course of infection (Fig. 2A and B).


Figure 2
View larger version (74K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 2. ReA in TNFRp55/ mice. (A) Progress of arthritis severity after infection: the data are expressed as the arthritis score for each group (n = 6–9) vs days after infection. The results are representative of one of the three experiments. (B) X-ray and histological examinations of the joints from wild-type C57BL/6 and TNFRp55/ mice on the onset of ReA (day 21): joints from wild-type C57BL/6 mice showed no X-ray and histological changes. Inflammation in the joints of TNFRp55/ mice was observed by X-ray. TNFRp55/ mice showed massive inflammatory infiltration with follicle formation in the synovial membrane, and cartilage and bone erosion (original magnification x 100), a thickened synovial lining cell layer was observed in TNFRp55/ mice (original magnification x 320). The score indices were calculated as described in Materials and methods. Values are the mean ± SD. Representative results from three independent experiments are shown.

 
Assessment of intra-articular antibodies against Yersinia antigens
At onset of the ReA (day 21), significantly higher levels of intra-articular antibodies against OMP (P < 0.04) were detected by ELISA in TNFRp55–/– mice compared with wild-type C57BL/6 mice (Fig. 3A). Joint extracts from uninfected mice of both groups of mice showed negative reactions (Fig. 3A). By dot blot, among different Yersinia antigen preparations, we detected stronger intra-articular antibody response to Yersinia SON and OMP antigens in TNFRp55–/– mice (Fig. 3B). By western blot, reaction with OMP of 35 and 40 kD was detected in the joint extracts from infected TNFRp55–/– mice (Fig. 3C). Joint extracts from uninfected mice of wild-type and TNFRp55–/– were negative by dot blot and western blot (data not shown). To confirm the role of OMP as the main target of the inflammatory response in the joints of TNFRp55–/– mice, we induced acute ReA in these mice [1]. We observed that OMP induced the highest histopathological scores (Fig. 4).


Figure 3
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 3. Articular antibodies to Yersinia antigens in wild-type and TNFRp55–/– mice at 21 days after infection. (A) ELISA: data are expressed as mean OD ± SD of 4–6 mice per group and are representative of one of the three independent experiments. Asterisks represent statistically significant values. (B) Dot blot: representative results from 3 mice per group are shown. (C) OMP SDS-PAGE and western blot. Representative results from 2 mice per group are shown.

 

Figure 4
View larger version (42K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 4. Acute arthritis induced by bacterial components in TNFRp55–/– mice. Uninfected TNFRp55–/–mice were intramuscularly injected with SON and after 7 days they were challenged with an intra-articular injection of PBS (control), LPS, Cyt or OMP. Histological changes on 7 days later are showed (original magnification x 320). The histological score indices were calculated as described in Materials and methods. Values are the mean ± SD (n = 4). Asterisks represent statistically significant values.

 
TNF-{alpha} protein and NO in the joint extracts
Because TNF-{alpha} plays a critical role in the pathogenesis of other arthritis [16], and excessive TNF-{alpha} production in the absence of TNFRp55-mediated signalling has been reported [17], we measured TNF-{alpha} levels in the joints of the mice at day 21. Significantly higher levels of articular TNF-{alpha} protein were detected in TNFRp55–/– mice (P < 0.05) (Fig. 5A). This result was in line with higher joint TNF-{alpha} mRNA expression in this group of mice (Fig. 5A). In contrast, no differences were detected in the expression of articular IFN-{alpha} and IL-10 mRNA expression between wild-type and TNFRp55–/– mice (data not shown).


Figure 5
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 5. TNF and NO levels in the joints of infected wild-type and TNFRp55–/– mice. (A) TNF-{alpha} mRNA and protein in the joint extracts of infected mice at day 21 after infection. TNF-{alpha} protein was determined by ELISA and values are the mean ± SD of the TNF-{alpha} levels of 4 mice per group. Total RNA from three pooled joint group was analysed by RT-PCR. (B) Nitrite production in uninfected and infected wild-type and TNFRp55–/– was determined in undiluted joint extracts at day 21 after infection. The values represent the mean + SD of 4–6 mice per group. (C) Western blot analysis of iNOS protein synthesis in uninfected and infected wild-type and TNFRp55–/– mice was determined in undiluted joint extracts at day 21 after infection. The results of the 3 mice per group are showed. Asterisks in (A) and (B) represent statistically significant values.

 
In addition, to explore the role of NO on the articular inflammatory response, we studied the levels of nitrite in the joint extracts. Interestingly, we observed a significantly lower levels of nitrite in the joints of TNFRp55–/– mice compared with wild-type mice (P < 0.02) (Fig. 5B). Western blot analysis to evaluate iNOS protein in the joint homogenates correlated with the amount of nitrite measured in the joints of both wild-type and TNFRp55–/– mice (Fig. 5C).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
In the present work, we studied the impact of TNFRp55 deficiency on the onset and progression of ReA after oral infection with Y. enterocolitica O:3. First, we observed that TNFRp55–/– mice displayed a significantly increased mortality rate after oral inoculation. As expected, this increased mortality occurred in the presence of increased bacterial burden in both MLN and the spleen on day 3 after infection, suggesting that an impaired bacterial clearance was responsible for this enhanced mortality. At this time of the infection, we studied IFN-{gamma}, TNF-{alpha} and IL-10 mRNA expression in MLN since the initial immune response to bacteria in mucosa could influence their dissemination to the joints. We observed an excessive induction of the pro-inflammatory cytokine mRNA (IFN-{gamma} and TNF-{alpha}) in TNFRp55–/– mice compared with wild-type mice, which suggest a dysregulated mucosal cytokine mRNA induction in the absence of TNFRp55 signalling. This cytokine dysregulation has been reported after other bacterial infection in TNFRp55–/– mice [17], and could support the hypothesis that intestinal inflammation with impairment of the gut : blood barrier may be operative in driving enteropathic arthritis [7]. Interestingly, mucosal and systemic bacterial clarifications were detected in TNFRp55–/– since no bacteria were detected in MLN and the spleen on days 21 and 56 after the infection, respectively. These results indicate that other antibacterial immune responses operate to induce bacterial clearance. Moreover, we detected the presence of the bacteria in the joints at day 3 after infection in both wild-type and TNFRp55–/– mice suggesting a synovial invasion of the pathogen. These results match with clinical and experimental reports of direct invasion of Yersinia which develops in typical cases of ReA after a short phase of bacterial arthritis [18]. Interestingly, even when bacterial burden was similar in both wild-type and TNFRp55–/– mice at day 3, this was significantly higher in knockout mice at day 21 after infection, indicating an impaired articular bacterial clarification in TNFRp55–/– mice and stressing the important local immune role of TNFRp55 signalling. However, at day 56, bacteria culture from joint extracts resulted negative, indicating that the bacteria does not persist in the synovia.

We observed that TNFRp55–/– mice developed progressive clinical arthritis with severe swelling and thickness in the joints. The X-ray and histological examinations in the affected joints revealed inflammation, synovial hypertrophy and cartilage/bone damage, resembling human ReA. The critical role of TNFRp55 in Yersinia-associated arthritis was demonstrated using a murine model of haematogenous Y. enterocolitica O:8 infection [6]. However, the present work is the first report of the role of TNFRp55 signalling on the development of ReA after an oral infection, which is the most frequent way of Yersinia infection and the results could support the pathogenic link between gut and synovial inflammation [7]. The progressive arthritis observed in the present work until day 56 could also suggest the protective role of TNFRp55 signalling against chronic ReA.

Since bacteria were clarified from the joint, following the accumulated evidence for the involvement of bacterial products in ReA [1, 19], we investigated antibody response to different bacterial antigens in the joint extracts of infected mice. We detected predominant intra-articular antibody response to OMP in TNFRp55–/– mice. Moreover, by OMP western blot, we observed in these mice reactions against OMP with molecular weights of 40 and 35 kD that correspond with those of porins [20]. Combined, these data indicate that OMP, with participation of porins, are the immunodominant antigens to articular antibody response in Y. enterocolitica-infected TNFRp55–/– mice. To address if OMP are the triggering bacterial antigens of ReA, we used an acute ReA model [1] and observed that SON-primed TNFRp55–/– mice developed more severe arthritis after intra-articular OMP challenge. Taken together, these results show that the OMP are the immunodominant antigens in ReA induced in TNFRp55–/– mice, which agree with clinical reports in Yersinia- and Salmonella-associated ReA [21, 22].

Finally, we investigated the articular immunodeficient mechanisms that influence the impaired bacterial antigen clarification and consequent joint inflammation in TNFRp55–/–. For this purpose, we studied the articular levels of cytokine mRNA and TNF-{alpha} protein, and observed a significant higher production of TNF-{alpha} mRNA and protein in the joints of infected TNFRp55–/– compared with wild-type mice on the onset of the ReA. This result suggests, as in other infection reports in TNFRp55–/– mice [5, 17], that joint TNF-{alpha} production was dysregulated in the absence of TNFRp55 signalling. Since TNFRp55–/– mice developed a severe arthritis, this TNF-{alpha} could not play, through the intact TNFRp75, an important role in host defence against Yersinia-triggered arthritis. Further studies could elucidate the role of TNF-{alpha} production as a pro-inflammatory cytokine in this murine arthritis model. Here, we observed dense mononuclear infiltrates in the synovia of TNFRp55–/– mice. These infiltrates contain macrophages which could secrete TNF-{alpha}. TNFRp55 is constitutively expressed in most tissues, whereas expression of TNFRp75 is highly regulated and is typically found in cells of the immune system. It has been demonstrated that TNFRp75 has a significant contribution for the development of chronic inflammatory diseases [23]. Taken together, it is likely that TNF-{alpha} plays a pro-inflammatory role in inflammed joints through the intact TNFRp75. Moreover, the positive clinical effects of anti-TNF-{alpha} therapy in patients with spondyloarthritis indicate that TNF-{alpha} contributes to the pathogenesis of this disease. In the other hand, since TNFRp55–/– mice were clearly susceptible to Yersinia oral infection and developed severe and progressive arthritis, TNF-{alpha} contributes to the bacteria and articular bacterial antigen clearance through TNFRp55. Thus, it is likely that TNF-{alpha} plays a two-edged role in ReA. In addition, since the precise role of NO in Yersinia-associated arthritis has not been completely clarified [6, 20], and there is evidence that NO plays an important role in the bacterial elimination but also in tissue damage [8], we analysed articular amount of nitrite, the stable end product of NO metabolism, and iNOS induction in the joints of the mice. We detected a defective articular nitrite levels and iNOS induction in infected TNFRp55–/– mice compared with wild-type mice. These results suggest that TNFRp55 signalling is required for the local reactive nitrogen intermediate pathway, which could participate in the bacterial antigen clarification in the joints. On the other hand, porins interfere with NO production [20]. Consequently, OMP antigens present in the TNFRp55–/– joint could induce high articular specific antibody response as discussed earlier, but also suppress NO production. Combined, these data suggest that bacterial antigens present in the joints, as a consequence of a host deficiency for early bacterial clearance, could contribute to reduce their clarification and perpetuate a chronic inflammation.

In this article, we have shown first that TNFRp55 plays a critical role for the protection against ReA induced by oral Y. enterocolitica O:3 infection, second that OMP are the bacterial antigens triggering arthritis, and finally that NO-dependent mechanisms could play a protective role against ReA. The recent introduction of TNF blockades in the treatment of ReA raised concerns about the ablation of TNF-associated functions in the post-infectious arthritis. This treatment may be beneficial in ReA since it is likely that TNF-{alpha} plays a pro-inflammatory role. However, caution is needed before starting anti-TNF-{alpha} therapy since TNF-{alpha} could also contribute to bacterial antigen clearance. The precise molecular mechanisms that participate in the development of ReA are clearly complex and will require additional studies. However, our results demonstrated the importance of the cytokine pathway in the defence against Yersinia-triggered arthritis, and could contribute to data to advance in specific and effective immunological therapies for this disease.

Formula


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
This work was carried out with the financial support of Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET, PIP 6224 and 2430) and National University of San Luis (Projects 0401 and 8803). M.S.G. is a member career of and M.G.L. fellow of CONICET.

The authors have declared no conflict of interest.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 

  1. Kyo F, Futani H, Matsui K, et al. (2005) Endogenous interleukin-6, but not tumor necrosis factor {alpha}, contributes to the development of Toll-like receptor 4/Myeloid differentiation factor 88-mediated acute arthritis in mice. Arthritis Rheum 52:2530–40.[CrossRef][Web of Science][Medline]
  2. Braun J, Yin Z, Spiller I, et al. (1999) Low secretion of tumor necrosis factor alpha, but not other Th1 or Th2 cytokines, by peripheral blood mononuclear cells correlates with chronicity in reactive arthritis. Arthritis Rheum 42:2039–44.[CrossRef][Web of Science][Medline]
  3. Anttonen K, Orpana A, Leirisalo-Repo M, Repo H. (2006) Aberrant TNF secretion by whole blood in healthy subjects with a history of reactive arthritis: time course in adherent and non-adherent cultures. Ann Rheum Dis 65:372–8.[Abstract/Free Full Text]
  4. Xanthoulea S, Pasparakis M, Kousteni S, et al. (2004) Tumor necrosis factor (TNF) receptor shedding controls thresholds of innate immune activation that balance opposing TNF functions in infectious and inflammatory diseases. J Exp Med 200:367–76.[Abstract/Free Full Text]
  5. Di Genaro MS, Waidmann M, Kramer U, Hitziger N, Bohn E, Autenrieth IB. (2003) Attenuated Yersinia enterocolitica mutant strains exhibit differential virulence in cytokine deficient mice: implications for the development of novel live carrier vaccines. Infect Immun 71:1804–12.[Abstract/Free Full Text]
  6. Zhao Y-X, Zhang H, Chiu B, Payne U, Inman RD. (1999) Tumor necrosis factor receptor p55 controls the severity of arthritis in experimental Yersinia enterocolitica infection. Arthritis Rheum 42:1662–72.[CrossRef][Web of Science][Medline]
  7. Miclants H and Veys EM. (1995) The gut and reactive arthritis. Rheumatol Eur 24:9–11.
  8. MacMicking J, Xie QW, Nathan C. (1997) Nitric oxide and macrophage function. Annu Rev Immunol 15:323–50.[CrossRef][Web of Science][Medline]
  9. Autenrieth IB, Kempf V, Sprinz T, Preger S, Schnell A. (1996) Defence mechanisms in Peyer's patches and mesenteric lymph nodes against Yersinia enterocolitica involve integrins and cytokines. Infect Immun 64:1357–68.[Abstract/Free Full Text]
  10. Banda NK, Vondracek A, Kraus D, et al. (2003) Mechanisms of inhibition of collagen-induced arthritis by murine IL-18 binding protein. J Immunol 170:2100–5.[Abstract/Free Full Text]
  11. Michiels T, Wattieau P, Brasseur R, Ruysschaert JM, Cornelis G. (1990) Secretion of Yop proteins by Yersiniae. Infect Immun 58:2840–9.[Abstract/Free Full Text]
  12. Trcek J, Wilharm G, Jacovi CA, Heesemann J. (2002) Yersinia enterocolitica Yop Q: strain-dependent cytosolic accumulation and post-translational secretion. Microbiology 148:1457–65.[Abstract/Free Full Text]
  13. Di Genaro MS, Muñoz E, Aguilera C, de Guzmán AMS. (2000) Yersinia enterocolitica O:8 and O:5 lipopolysaccharide arthritogenicity in hamsters. Rheumatology 39:73–8.[Abstract/Free Full Text]
  14. Brown CR, Blaho VA, Laiacono CM. (2003) Susceptibility to experimental Lyme arthritis correlates with KC and monocyte chemoattractant protein-1 production in joints and requires neutrophil recruitment via CXCR2. J Immunol 171:893–901.[Abstract/Free Full Text]
  15. Green L, Wagner D, Glogowski J, Skipper P, Wishnok J, Tannenboum S. (1982) Analysis of nitrate, nitrite and (15 N) nitrate in biological fluids. Ann Biochem 126:131–8.
  16. Feldmann M. (2002) Development of anti-TNF therapy for rheumatoid arthritis. Nat Rev Immunol 2:364–71.[CrossRef][Web of Science][Medline]
  17. Moore TA, Perry ML, Getsoian AG, Monteleon CL, Cogen AL, Standiford TJ. (2003) Increased mortality and dysregulated cytokine production in tumor necrosis factor receptor 1-deficient mice following systemic Klebsiella pneumoniae infection. Infect Immun 71:4891–900.[Abstract/Free Full Text]
  18. Di Genaro MS, Escudero ME, Muñoz E, et al. (1998) Arthritogenicity of Yersinia enterocolitica O:8 in hamsters: analysis of the immune response. Folia Microbiol 43:690–6.
  19. Granfors K, Jalkanen S, von Essen R, et al. (1989) A. Yersinia antigens in synovial fluid cells from patients with reactive arthritis. N Eng J Med 322:216–21.
  20. Tufano MA, Rossano F, Catalanotti P, et al. (1994) Properties of Yersinia enterocolitica porins: interference with biological functions of phagocytes, nitric oxide production and selective cytokine release. Res Microbiol 145:297–307.[Medline]
  21. Maki-Ikola O, Hill JL, Lahesmaa R, Toivanen A, Granfors K. (1992) IgG and IgA antibody response against porins in Yersinia-triggered reactive arthritis. Br J Rheumatol 31:315–8.[Abstract/Free Full Text]
  22. Saxena S, Aggarwal A, Misra R. (2005) Outer membrane protein of Salmonella is the major antigenic target in patients with Salmonella induced reactive arthritis. J Rheumatol 32:86–92.[Abstract/Free Full Text]
  23. Wajant H, Pfizenmaier K, Scheurich P. (2003) Tumor necrosis factor signaling. Cell Death Differ 10:45–65.[CrossRef][Web of Science][Medline]
Submitted 2 July 2006; revised version accepted 8 September 2006.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
46/4/590    most recent
kel348v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Di Genaro, M. S.
Right arrow Articles by de Guzmán, A. M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Di Genaro, M. S.
Right arrow Articles by de Guzmán, A. M. S.
Related Collections
Right arrow Spondylarthropathies
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?