Rheumatology Advance Access originally published online on November 3, 2006
Rheumatology 2007 46(4):657-665; doi:10.1093/rheumatology/kel346
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Distinct expression pattern of IFN-
and TNF-
in juvenile idiopathic arthritis synovial tissue
Second Division of Pediatrics, G. Gaslini Institute for Children and University of Genoa, Genoa, Italy and 1Institute of Research in Biomedicine, Bellinzona, Switzerland.
Correspondence to: M. Gattorno, MD, Second Division of Pediatrics, G. Gaslini Institute and University of Genoa, Largo G. Gaslini 5, 16147, Genoa, Italy. E-mail: marcogattorno{at}ospedale-gaslini.ge.it
| Abstract |
|---|
|
|
|---|
Objectives. Recent laboratory and clinical data suggest that two prototype autoimmune diseases, systemic lupus erythematosus and rheumatoid arthritis are mainly driven by distinct cytokines, interferon (IFN)-
and tumour necrosis factor (TNF)-
, respectively. We here investigated the presence and characteristics of natural type I IFN-producing cells (IPCs), as well as IFN-
and TNF-
expression at sites of inflammation in juvenile idiopathic arthritis (JIA).
Methods. Peripheral blood (PB) and synovial fluid (SF) mononuclear cells (MNCs) (n = 25 each) from JIA patients with active disease were studied. IPCs were identified as BCDA-2+CD123+HLA-DR+CD45RA+ cells, and dendritic cells (DCs) as CD11c+CD14/lowlin cells by flow cytometry. IPCs and DCs were analysed for Toll-like receptor-7 and -9 mRNA expression by real-time polymerase chain reaction. IFN-
was measured by enzyme-linked immunosorbent assay in serum, SF and in supernatants of influenza virus-infected, cultured IPCs. Synovial tissues of n = 6 additional JIA patients were analysed by immunohistochemistry using mAbs against CD123, IFN-
, TNF-
, CD3, CD19 and CD138.
Results. IPCs were enriched in SF MNCs compared with PB MNCs in all JIA patients. Influenza-induced, but no spontaneous IFN-
release was detected from SF IPCs, and serum and SF IFN-
levels were not elevated. Nonetheless, in synovial tissue IFN-
producing cells accumulated at inflammatory lymph-follicular-like structures, while TNF-
producing cells were mostly found at the lining and sublining layers.
Conclusions. These data suggest that besides TNF-
-expressing cells, IFN-
-producing IPCs are involved in initiation, maintenance or regulation of the inflammatory response in JIA.
KEY WORDS: Interferon-
, Plasmacytoid cells, Dendritic cells, Juvenile idiopathic arthritis
| Introduction |
|---|
|
|
|---|
Dendritic cells (DCs) are professional antigen-presenting cells, capable of initiating primary adaptive immune responses [1]. Immature DCs continuously sample antigens in tissues, and upon maturation, migrate to local lymphoid organs and present these antigens to lymphocytes [1, 2]. Natural type I interferon (IFN)-producing cells (IPCs) are a distinct small subset of circulating leucocytes, characterized by their typical (plasma cell-like) morphology [3, 4], and by their capacity to produce high amounts of type I IFN (
and ß) in response to viral infections [5, 6] or bacterial DNA containing unmethylated CG dinucleotide (CpG motifs) [2, 79]. IPCs are found in secondary lymphoid organs, express MHC class II molecules, and upon stimulation, mature to antigen-presenting cells, at least in vitro [10]. Therefore, IPCs were included in the DC family and were also termed as plasmacytoid pre-DCs (PDCs) [1].
As major IFN-
producers, IPCs play an important role in the regulation of immune responses by influencing T-cell activation and functional orientation [7, 11, 12], DC maturation [13], B-cell activation and plasma-cell differentiation [14] (for review see [2]). However, if dysregulated, IFN-
might lead to autoimmune diseases [15, 16]. Important evidence for this comes from several observations: patients treated with IFN-
for viral and malignant diseases are at risk for the development of autoimmune disorders [1720]; elevated levels of IFN-
were found in sera of systemic lupus erythematosus (SLE) patients during disease flares [21]; cells with morphological and phenotypic characteristics of IPCs were shown to infiltrate skin lesions in SLE [22] and psoriasis [23]; and finally, microarray analysis demonstrated transcription of IFN-inducible genes in blood mononuclear cells (MNCs) from SLE patients [24]. How IPCs are activated to produce IFN-
in SLE is not fully understood; however, IPCs are thought to respond to immune-complexes formed by autoantibodies and DNA or RNA molecules derived from apoptotic cells [15].
In contrast to SLE, both clinical and laboratory data suggest that in chronic idiopathic arthritis tumour necrosis fator (TNF)-
is involved in development and maintenance of the disease [25]. Thus, it was proposed that different cytokine expression patterns characterize different autoimmune diseases, with IFN-
having a prominent role in SLE, and TNF-
in chronic inflammatory arthritis [16, 26]. However, this dichotomy might not be mutually exclusive as occasional rheumatoid arthritis (RA) onset during IFN-
treatment was reported [18], and cells with phenotypic and functional characteristics of IPCs were found to infiltrate the inflamed synovial tissue in adult RA [2729]. Whereas previous studies have characterized the role of DC in adult RA [30, 31] and juvenile idiopathic arthritis (JIA) [32], no information is available on the possible role of IPCs in JIA. Here we analyse IPCs and DCs as well as IFN-
and TNF-
expression at the site of inflammation in JIA patients.
| Materials and methods |
|---|
|
|
|---|
Patient and control samples
Parent informed consent was obtained according to institutional guidelines. Peripheral blood (PB) and synovial fluid (SF) samples of 25 consecutive patients with active JIA undergoing therapeutic arthrocentesis for steroid injection (F : M, 20 : 5) were analysed. Thirteen patients had a persistent oligoarticular form, ten an extended oligoarticular form, and two an RF-negative polyarticular form according to ILAR Durban criteria [33]. Clinical characteristics of JIA patients and treatment at study time are presented in Table 1. Synovial tissue samples were obtained from additional six JIA patients (Table 2). PB MNCs from age-matched healthy controls [n = 8; no history of inflammatory or infectious disorders within 4 weeks before examination and normal erythrocyte sedimentaion rate (ESR) and C-reactive protein (CRP)] attending our clinic for routine pre-operative examinations before minor surgery were used after parent informed consent was obtained. IPCs isolated from healthy adult PB MNCs were used as controls as indicated.
|
|
Samples were taken from patients and healthy controls, and stored after parental permission in accordance with the informed consent approved by the Ethical Committee of the G. Gaslini Institute.
Sample preparation, flow cytometry and cell sorting
PB and SF MNCs were isolated by Ficoll-Hypaque (Sigma, St Louis, MO, USA) density gradient centrifugation. Cells were stored in 90% fetal calf serum (FCS) and 10% dimethylsulfoxide (DMSO) in liquid nitrogen until evaluation. Monoclonal antibodies (mAbs), conjugated with either FITC, PE, CyChrome or APC, against the following antigens were used: BDCA-2 (Ac144, Mylteni, Bergisch Gladbach, Germany), CD11c (3.9, eBioscience, San Diego, CA, USA), CD123 (9F5, BD Pharmingen, Franklin Lakes, NJ, USA), CD56 (B159, BD Pharmingen), CXCR3 (1C6, BD Pharmingen), CCR7 (150503, R&D Systems, Minneapolis, MN, USA), CD3 (S4.1, Caltag, Burlingame, CA, USA), CD19 (sJ25-C1, Caltag), HLA-DR (Immu-357), CD14 (RMO52), CD45RA (2H4), CD80 (MAB 104), CD83 (HB15A), CD86 (HA5-2B7), CD40 (MAB 89), CD62L (DREG 56) (all Immunotech, Marseille, France). PB and SF IPCs were identified as CD123+BCDA-2+ cells. For evaluation of IFN-
production, PB IPCs were isolated from adult healthy donors and SF IPCs were sorted as CD123+CD3CD19CD14CD56 cells since BDCA-2 ligation on IPCs blocks IFN-
production [34]. Monocytes were characterized as CD11c+CD14high cells, and DCs as CD11c+CD14/low CD3CD19CD56 cells. Flow cytometric analysis and sorting was performed using a flow activated cell sorting (FACS) Calibur and FACS Vantage SE, respectively (Beckton Dickinson, San Jose, CA, USA). Isotype-matched, irrelevant mAbs were used to determine the level of background staining.
INF-
production and measurement
To test INF-
production capacities, cells were plated in U-bottom 96-wells and were infected overnight with 1 : 30 40 HAU (HAU = haemagglutinin units) dilution of influenza virus (strain A/Beijing/353/89 kind gift of I. Julkunen) or CpG 2216 (5 µg/ml; Microsynth, Balgach, Switzerland) as previously reported [9]. INF-
was measured in culture supernatants by enzyme-linked immunosorbent assay according to the manufacturer instructions (PBL Biomedical Laboratories). Values were normalized to 1000 input cells. To evaluate intracellular IFN-
content, influenza-stimulated and unstimulated IPCs were spun on slides and were stained for IFN-
(MMHA-3, PBL laboratories, Piscataway, NJ, USA) and were revealed with alkaline phosphatase anti-alkaline phosphatase complex (APAAP, Dako, Glostrup, Denmark), using fucsin as chromogen.
In addition, IFN-
levels were measured in sera and SF of 20 JIA patients and in sera of 10 age-matched healthy controls.
Dendritic cell activation
Monocytes (CD11c+CD14high) and DCs (CD11c+CD14/low) sorted from SF as well as from healthy PB MNC donors were cultured overnight in RPMI 1640 media (Gibco) supplemented with 10% FCS, 100 ng/ml granulocyte macrophage colony stimulating factor (GM-CSF) (Leukomax, Novartis, Switzerland), 20 ng/ml interleukin (IL)-4 (R&D Systems) and 0.1 µg/ml lipopolysaccharide (LPS) (Sigma Chemicals Co.).
Semiquantitative PCR analysis
IPCs and DCs were sorted from SF and RNA was isolated using TRIZOL reagent, according to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA). RNA samples were treated with DNase I (Invitrogen) to remove contaminating genomic DNA, and first-strand cDNA was synthesized using random primers and Superscript II reverse transcriptase (Invitrogen). Real-time PCR was performed using an ABI PRISM 7700 Sequence Detector (Perkin-Elmer) and TaqMan target mixes (Applied Biosystems). Amplification of endogenous ß-actin (ACTB Hs 99999903 m1) was done for each experimental sample as a control and reference accounting for differences in the amount and quality of total cDNA added to each reaction. Pre-TCR alpha chain was detected using target mix PTCRA (Hs 00300125 m1). For detection of Toll-like receptors (TLRs), the following sequences of primers and probes were used: TLR2 (F: CAGCACTGGTGTCTGGCATG, probe: CTGTGCTCTGTTCCTGCTGATCCTGC, R: GAGCCAGGCCCACATCATT), TLR4 (F: GTTTCCTGCAATGGATCAAGGA, probe: TCGTTCAACTTCCACCAAGAGCTGCCT, R: TGCTTATCTGAAGGTGTTGCACAT) TLR7 (F: TTACCTGGATGGAAACCAGCTACT, probe: AGATACCGCAGGGCCTCCCGC; R: TCAAGGCTGAGAAGCTGTAAGCTA), TLR9 (F: TGAAGACTTCAGGCCCAACTG, probe: AGCACCCTCAACTTCACCTTGGATCTGTC, R: TGCACGGTCACCAGGTTGT).
Immunohistochemistry
Tissue specimens were prepared for immunohistochemical stainings according to standard technique [35]. Briefly, specimens were fixed in 10% formalin for 4 h, dehydrated and embedded in paraffin. Sections of 4 µm were cut and layered on polylysine-coated slides. Slides were deparaffinized in xylene and rehydrated in descending grade (10070%) of ethanol. Serial tissue sections were incubated overnight at +4°C with mouse Abs against CD123 (9F5, BD Pharmingen), INF-
(MMHA-3, PBL laboratories, Piscataway, NJ, USA) and for 30 min with Abs against CD3 (polyclonal, Dako), CD20 (L26, Dako), DC-LAMP (104.G4, Immunotech), CD1a (010, Immunotech), CD68 (KP1, Dako), TNF-
(4C6-H8, MONOSAN-Netherlands), CD138 (MI15, Dako) and CD117 (c-kit, polyclonal, Dako). Secondary labelling was performed for 30 min at room temperature with an anti-mouse Ig antibody conjugated to peroxidase labelled-dextran polymer (EnVision, Dako). The chromogenic diaminobenzidine substrate (DAB, Dako) was applied for 10 min. Slides were washed in PBS and were counterstained with Mayer's haematoxylin. Reactions in the absence of primary antibody and with isotype-matched, irrelevant antibodies (anti-cytomegalovirus, clones DDG9 and CCH2, Dako) were carried out as negative controls.
Statistical analysis
Percentages of PB and SF cell populations, and serum and SF IFN-
levels were compared by non-parametric Wilcoxon rank test. Differences with normal controls were calculated using MannWhitney U-test. Correlations among all the variables considered were evaluated using Spearman rank test.
| Results |
|---|
|
|
|---|
IPCs and immature DCs are enriched in SF compared with peripheral blood in JIA patients
Cells with phenotypic characteristics of IPCs (CD123+BDCA-2+) were identified in both PB and SF of all 25 JIA patients (Table 1, Fig. 1A). In 15 JIA patients, PB and SF monocytes (CD11c+CD14high) and DC (DC, CD11c+CD14/low) were also characterized (Fig. 1B). Notably, when SF CD11c+CD14high and CD11c+CD14/low cells were sorted and cultured overnight in media supplemented with LPS, GM-CSF and IL-4, the latter population acquired typical DC morphology, supporting the assumption that CD11c+CD14/low cells were immediate DC precursors or DCs, whereas CD11c+CD14high cells maintained monocyte-like characteristics (Supplementary Fig. 1). In all 25 patients, IPCs were enriched in SF compared with PB (median 1.6%; range 0.83 vs 0.35%, range 0.11.7% of MNCs, respectively; P < 0.0001) (Fig. 2A). Similarly, in all 15 patients studied, DCs (CD11c+CD14/low) and monocytes (CD11c+CD14high) were enriched in SF compared with PB (SF DCs median 6.3%, range 1.518%; PB DCs median 0.9%, range 0.53.4%; P = 0.0002; SF monocytes median 15.9%, range 5.138.4%; PB monocytes median 9.4%, range 3.428%; P = 0.009) (Fig. 2B and data not shown). No significant differences were found in percentages of PB IPCs and DCs between JIA patients and age-matched healthy controls, respectively (Fig. 2A and B).
|
|
Percentages of DCs and IPCs in PB and SF did not significantly correlate with parameters of disease activity (number of active joints, physician global score, ERS) or with the disease subtype. Interestingly, however, a trend towards a higher percentage of IPCs in SF of ANA-positive patients (n = 20) compared with ANA-negative patients (n = 5) was observed (median 2.1%, range 0.453.2, vs 1.07%, range 0.481.9%; P = 0.06, MannWhitney U-test).
JIA synovial fluid IPCs display low, while DCs display enhanced levels of activation compared with their respective peripheral blood counterparts
We next studied phenotypical features of PB and SF IPCs, DCs and monocytes. In all three SF populations, CD40 was slightly up-regulated compared with PB (Fig. 3A and B). Costimulatory molecules as CD80 and CD86, as well as CD83, displayed some degree of up-regulation in SF DCs, but were not up-regulated in SF IPCs (Fig. 3 and data not shown). Both chemokine receptors CXCR3 and CCR7 [36] were variably, but not substantially different, expressed in both PB and SF IPCs. In contrast, the homing molecule CD62L (L-selectin), was expressed on circulating IPCs, and was down-regulated on SF IPCs (Fig. 3).
|
As expected, IPCs isolated from SF expressed mRNA of TLR-7 and -9, but not of TLR-2 and -4, which in contrast were expressed by CD11c+CD14/low DC (Supplementary Fig. 2).
Thus, IPC isolated from JIA SF display typical phenotypic features of this particular cell subpopulation in terms of surface markers and TLR expression, but in accordance with recent studies in adult spondyloarthropathy (SpA) [27] and RA [28], display little phenotypic activation, while SF monocytes and DCs appear somewhat activated with respect to costimulatory molecule, CD83 and CD40 expression.
JIA synovial fluid IPCs contain but do not spontaneously release IFN-
We next evaluated functional activity of JIA patient SF IPCs. Because for both ethical and practical reasons, we were not able to obtain sufficient amounts of PB IPCs from JIA children, PB IPCs from healthy adult blood donors were used as controls in these experiments. Control PB IPCs displayed typical morphology of resting cells and did not contain intracellular IFN-
(Supplementary Fig. 3A). Upon stimulation with influenza virus or CpG, PB IPC developed DC-like morphology and stained positive for intracellular IFN-
(Supplementary Fig. 3B). Notably, a number of SF IPCs displayed a DC-like morphology, and some stained positive for IFN-
(Supplementary Fig. 3C). Although JIA SF IPCs did not spontaneously release IFN-
in culture supernatants, IFN-
release upon influenza virus or CpG stimulation from two SF samples tested was comparably efficient as observed from stimulated healthy donor peripheral blood IPCs (Supplementary Fig. 3D) [9]. Thus, compared with circulating healthy donor IPCs, JIA SF IPCs are somewhat activated with respect to DC-like morphology and intracellular IFN-
content.
In line with lacking spontaneous IFN-
release from JIA SF IPCs, IFN-
levels in SF were low (median 92 pg/ml, range 63149 pg/ml, n = 20), and did not obviously differ from IFN-
levels in sera of both JIA patients (129 pg/ml, range 67209 pg/ml, n = 20) and healthy controls (139 pg/ml, 20184 pg/ml, n = 12).
IFN-
-expressing IPCs preferentially localize around lymphocyte aggregates while TNF-
-expressing cells mainly localize at the lining and sublining layer in JIA synovial tissue
Although SF is providing important information on disease activity, the primary inflammatory reaction in JIA occurs in synovial tissues. We thus studied synoviectomy tissues of six additional JIA patients (Table 2). Clusters of CD20 and CD3-positive cells, forming lymph-follicular aggregates were observed in five samples; however, none showed clear germinal centre reactions [37]. One sample displayed a diffuse lymphocytic infiltration with predominant CD3+ T-cell and few scattered CD20+ B-cell infiltrates [37].
IPCs were identified as cells with plasmacytoid morphology and co-localization of CD123+ and IFN-
+ in serial sections. IPCs were found mainly in areas surrounding T- and B-cell aggregates (Fig. 4AD), and in some areas in less-organized lymphocytic infiltrates in the sublining layer (Fig. 4EH). Since CD123 is expressed in synovial tissue on endothelial cells [37] and on mast cells besides on IPCs, [38] those cell types needed to be carefully excluded from the analysis. However, endothelial cells did not stain for IFN-
+ (Fig. 4H). Furthermore IFN-
and c-kit (CD117), the receptor for stem cell factor expressed on mast cells, was differently distributed in serial sections (Fig. 4IK). Interestingly, in all TB lymphoid aggregates observed (n = 5), IPCs were found in close anatomical relationship with CD138+ plasma cells (Fig. 5AD). In contrast to IFN-
, TNF-
was prominently expressed in the lining and sublining layers either by cells of the monocyte-macrophage lineage (CD68+) and by resident fibroblast-like synoviocytes (CD68) (Fig. 5EJ and Table 2). Only scattered TNF-
+ cells were found in the context of the lymphoid aggregates, but with a different localization than IFN-
-producing cells (Fig. 5EG). Taken together, in inflammatory JIA tissues IFN-
-producing IPCs accumulate at lymph-follicular-like structures while TNF-
-producing cells are mostly found at the lining and sublining layers.
|
|
| Discussion |
|---|
|
|
|---|
Based on the findings in paediatric patients affected by systemic onset JIA and SLE it was proposed that two prototype autoimmune diseases, SLE and RA are mainly driven by distinct cytokines, IFN-
and TNF-
, respectively [13, 16, 26]. However, it is not clear if these observations on peripheral blood extend to the sites of tissue inflammation. Indeed, the primary initiators and cellular composition of the inflammatory infiltrate in JIA are not fully defined. Here we describe for the first time that IPCs accumulate at the sites of inflammation in JIA and that these IFN-
-producing cells show a different distribution compared with TNF-
-producing cells in inflamed synovial tissue. SF IPC numbers were about 5-fold increased compared with PB IPCs; SF IPCs displayed activated, DC-like morphology and contained intracellular IFN-
at levels comparable with those found in stimulated but not in ex vivo isolated, healthy donor peripheral blood IPCs. However, SF IFN-
levels were not elevated, and besides morphology and intracellular IFN-
content, SF IPCs did not show signs of activation as evaluated by costimulatory molecule expression. Furthermore, we show that DCs that display some signs of activation but are not fully matured, are about 7-fold increased in SF compared with PB.
Our findings on SF IPCs in JIA are in line with parallel, recently published studies which demonstrated accumulation of non-activated SF IPC and lack of IFN-
elevation in adult SpA and RA SF [27, 28]. In these, it was suggested that IPCs are actively recruited to SF but that IFN-
release was inhibited by so far non-defined soluble factors [28]. Given that the primary site of inflammation in JIA is synovial tissue (ST), SF might only serve as a surrogate for ST disease, and need to be interpreted in this context. We thus evaluated ST: here CD123+ IFN-
+ cells with plasma cell-like morphology, i.e. IPCs, accumulated at perivascular lymph-follicular-like aggregates [29]. In contrast, TNF-
-producing cells were mostly found at the lining and sublining layers.
As IPCs are demonstrated to be enriched in diverse autoinflammatory lesions [2, 22, 23, 28], it might be argued that IPC enrichment is a general, unspecific sign of chronic autoimmune disease. However, the peculiar distribution of IFN-
-producing cells in the context of synovial tissue may indicate an actual role of this cell population in the pathophysiology of JIA.
Elevated SF TNF-
levels have been demonstrated in JIA [39, 40] and anti-TNF-
therapy has been proven effective [41, 42]. In line with this, here we found TNF-
expressed at the level of sublining and lining layer and an accumulation of DCs and monocytes in the SF that likely produce it there. Thus, TNF-
might critically contribute in the activation of the inflammatory response and determination of tissue damage. With ongoing inflammation, IPCs might be recruited to inflamed synovial tissue together with B and T cells [28], likely via a CD62L-dependant mechanism, and consecutively enter the SF. Indeed, we found this homing molecule down-regulated on SF IPCs.
At inflammatory sites then, multiple cellular cross-regulatory interactions will occur. IPCs might be stimulated to produce IFN-
by immune complexes formed of anti-nuclear autoantibodies and DNA or RNA molecules via Fc
RII [15] or apoptotic cell-derived unmethylated CpG-DNA molecules via TLR-9 [15]. These same mechanisms potentially contribute to IPC activation in JIA. In SF, however, monocyte and possibly DC-produced TNF-
might inhibit major IFN-
release from IPCs [2628], while some level of IFN-
production by IPCs in turn might initiate DC maturation [13], both features fitting with the data demonstrated here. In tissues, however, IFN-
-producing IPCs might sustain the autoimmune response by induction of plasma-cell differentiation [14] in a paracrine manner. In line with this, we found IPCs in the vicinity of CD138 expressing plasma cells at ST lymph-follicular infiltrates and higher proportion of IPCs in the SF of ANA-positive JIA patients (although not significant at this sample size). In this context, it is particularly intriguing that lymph-follicular aggregate formation in JIA correlates positively with the production of anti-nuclear autoantibodies [43].
On the other hand, CpG-stimulated IPCs have been shown to prime allogeneic CD4+CD25 T cells to differentiate into CD4+CD25+ regulatory T (Treg) cells [44]. These findings together with our recent observation of CD4+CD25+ Treg cell accumulation around the follicular aggregates in synovial tissue in JIA patients [45], might point to a regulatory role of IPCs in the inflamed synovium.
As most clinical data, the current findings on a heterogeneous group of JIA patients are descriptive and do not allow definitive conclusions. To establish the role of IPCs in initiation vs maintenance of disease, it will be helpful to compare primary manifestation with established disease patient groups. However, the study presented here provides the first definitive evidence that IFN-
-producing IPCs are part of the inflammatory response, suggesting a complementary rather than an alternative contribution of IFN-
and TNF-
in the pathogenesis of JIA. Given these findings together with previous data on RA [2729], the current classification of autoimmune diseases according to a TNF-
or IFN-
dichotomy is helpful; however, it might be somewhat too simplistic and likely to be refined in future studies.
| Acknowledgements |
|---|
|
|
|---|
This work was partially funded by the Italian Ministry of Health (Ricerca Corrente).
The authors have declared no conflicts of interest.
| References |
|---|
|
|
|---|
- Banchereau J and Steinman RM. (1998) Dendritic cells and the control of immunity. Nature 392:24552.[CrossRef][Medline]
- Liu YJ. (2005) IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors. Annu Rev Immunol 23:275306.[CrossRef][ISI][Medline]
- Vollenweider R and Lennert K. (1983) Plasmacytoid T-cell clusters in non-specific lymphadenitis. Virchows Arch B Cell Pathol Incl Mol Pathol 44:114.[ISI][Medline]
- Facchetti F, Wolf-Peeters C, Mason DY, Pulford K, van den Oord JJ, Desmet VJ. (1988) Plasmacytoid T cells. Immunohistochemical evidence for their monocyte/macrophage origin. Am J Pathol 133:1521.[Abstract]
- Heil F, Hemmi H, Hochrein H, et al. (2004) Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science 303:15269.
[Abstract/Free Full Text] - Diebold SS, Kaisho T, Hemmi H, Akira S. (2004) Reis e Sousa Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303:152931.
[Abstract/Free Full Text] - Kadowaki N, Ho S, Antonenko S, et al. (2001) Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med 194:8639.
[Abstract/Free Full Text] - Krug A, Towarowski A, Britsch S, et al. (2001) Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12. Eur J Immunol 31:302637.[CrossRef][ISI][Medline]
- Jarrossay D, Napolitani G, Colonna M, Sallusto F, Lanzavecchia A. (2001) Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells. Eur J Immunol 31:338893.[CrossRef][ISI][Medline]
- Grouard G, Rissoan MC, Filgueira L, Durand I, Banchereau J, Liu YJ. (1997) The enigmatic plasmacytoid T cells develop into dendritic cells with interleukin (IL)-3 and CD40-ligand. J Exp Med 185:110111.
[Abstract/Free Full Text] - Cella M, Facchetti F, Lanzavecchia A, Colonna M. (2000) Plasmacytoid dendritic cells activated by influenza virus and CD40L drive a potent TH1 polarization. Nat Immunol 1:30510.[CrossRef][ISI][Medline]
- Krug A, Veeraswamy R, Pekosz A, et al. (2003) Interferon-producing cells fail to induce proliferation of naive T cells but can promote expansion and T helper 1 differentiation of antigen-experienced unpolarized T cells. J Exp Med 197:899906.
[Abstract/Free Full Text] - Blanco P, Palucka AK, Gill M, Pascual V, Banchereau J. (2001) Induction of dendritic cell differentiation by IFN-alpha in systemic lupus erythematosus. Science 294:15403.
[Abstract/Free Full Text] - Jego G, Palucka AK, Blanck JP, Chalouni C, Pascual V, Banchereau J. (2003) Plasmacytoid dendritic cells induce plasma cell differentiation through type I interferon and interleukin 6. Immunity 19:22534.[CrossRef][ISI][Medline]
- Ronnblom L and Alm GV. (2001) A pivotal role for the natural interferon alpha-producing cells (plasmacytoid dendritic cells) in the pathogenesis of lupus. J Exp Med 194:F5963.
[Free Full Text] - Banchereau J, Pascual V, Palucka AK. (2004) Autoimmunity through cytokine-induced dendritic cell activation. Immunity 20:53950.[CrossRef][ISI][Medline]
- Abdi EA, Brien W, Venner PM. (1984) Auto-immune thrombocytopenia related to interferon therapy. Scand J Haematol 36:5159.
- Ronnblom LE, Alm GV, Oberg KE. (1991) Autoimmunity after alpha-interferon therapy for malignant carcinoid tumors. Ann Intern Med 115:17883.[ISI][Medline]
- Ioannou Y and Isenberg DA. (2000) Current evidence for the induction of autoimmune rheumatic manifestations by cytokine therapy. Arthritis Rheum 43:143142.[CrossRef][ISI][Medline]
- Raanani P and Ben Bassat I. (2002) Immune-mediated complications during interferon therapy in hematological patients. Acta Haematol 107:13344.[CrossRef][ISI][Medline]
- Ytterberg SR and Schnitzer TJ. (1982) Serum interferon levels in patients with systemic lupus erythematosus. Arthritis Rheum 25:4016.[ISI][Medline]
- Farkas L, Beiske K, Lund-Johansen F, Brandtzaeg P, Jahnsen FL. (2001) Plasmacytoid dendritic cells (natural interferon- alpha/beta-producing cells) accumulate in cutaneous lupus erythematosus lesions. Am J Pathol 159:23743.
[Abstract/Free Full Text] - Wollenberg A, Wagner M, Gunther S, et al. (2002) Plasmacytoid dendritic cells: a new cutaneous dendritic cell subset with distinct role in inflammatory skin diseases. J Invest Dermatol 119:1096102.[CrossRef][ISI][Medline]
- Baechler EC, Batliwalla FM, Karypis G, et al. (2003) Interferon-inducible gene expression signature in peripheral blood cells of patients with severe lupus. Proc Natl Acad Sci USA 100:26105.
[Abstract/Free Full Text] - Feldmann M, Brennan FM, Williams RO, Woody JN, Maini RN. (2004) The transfer of a laboratory based hypothesis to a clinically useful therapy: the development of anti-TNF therapy of rheumatoid arthritis. Best Pract Res Clin Rheumatol 18:5980.[CrossRef][Medline]
- Palucka AK, Blanck JP, Bennett L, Pascual V, Banchereau J. (2005) Cross-regulation of TNF and IFN-alpha in autoimmune diseases. Proc Natl Acad Sci USA 102:33727.
[Abstract/Free Full Text] - Van Krinks CH, Matyszak MK, Hill Gaston JS. (2004) Characterization of plasmacytoid dendritic cells in inflammatory arthritis synovial fluid. Rheumatology 43:45360.
[Abstract/Free Full Text] - Lande R, Giacomini E, Serafini B, et al. (2004) Characterization and recruitment of plasmacytoid dendritic cells in synovial fluid and tissue of patients with chronic inflammatory arthritis. J Immunol 173:281524.
[Abstract/Free Full Text] - Cavanagh LL, Boyce A, Smith L, et al. (2005) Rheumatoid arthritis synovium contains plasmacytoid dendritic cells. Arthritis Res Ther 7:R23040.[CrossRef][ISI][Medline]
- Thomas R, MacDonald KP, Pettit AR, et al. (1999) Dendritic cells and the pathogenesis of rheumatoid arthritis. J Leukoc Biol 66:28692.[Abstract]
- Radstake TR, van Lieshout AW, van Riel PL, van den Berg WB, Adema GJ. (2005) Dendritic cells, Fc{gamma} receptors, and Toll-like receptors: potential allies in the battle against rheumatoid arthritis. Ann Rheum Dis 64:15328.
[Abstract/Free Full Text] - Varsani H, Patel A, van Kooyk Y, Woo P, Wedderburn LR. (2003) Synovial dendritic cells in juvenile idiopathic arthritis (JIA) express receptor activator of NF-kappaB (RANK). Rheumatology 42:58390.
[Abstract/Free Full Text] - Petty RE, Southwood TR, Baum J, et al. (1997) Revision of the proposed classification criteria for juvenile idiopathic arthritis: Durban, 1997. J Rheumatol 25:19914.
- Dzionek A, Sohma Y, Nagafune J, et al. (2001) BDCA-2, a novel plasmacytoid dendritic cell-specific type II C-type lectin, mediates antigen capture and is a potent inhibitor of interferon alpha/beta induction. J Exp Med 194:182334.
[Abstract/Free Full Text] - Gattorno M, Gerloni V, Morando A, et al. (2002) Synovial membrane expression of matrix metalloproteinases and tissue inhibitor 1 in juvenile idiopathic arthritides. J Rheumatol 29:17749.[ISI][Medline]
- Penna G, Vulcano M, Sozzani S, Adorini L. (2002) Differential migration behavior and chemokine production by myeloid and plasmacytoid dendritic cells. Hum Immunol 63:116471.[CrossRef][ISI][Medline]
- Cella M, Jarrossay D, Facchetti F, et al. (1999) Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat Med 5:91923.[CrossRef][ISI][Medline]
- Gebhardt T, Sellge G, Lorentz A, Raab R, Manns MP, Bischoff SC. (2002) Cultured human intestinal mast cells express functional IL-3 receptors and respond to IL-3 by enhancing growth and IgE receptor-dependent mediator release. Eur J Immunol 32:230816.[CrossRef][ISI][Medline]
- Gattorno M, Picco P, Buoncompagni A, et al. (1996) Serum p55 and p75 tumour necrosis factor receptors as markers of disease activity in juvenile chronic arthritis. Ann Rheum Dis 55:2437.
[Abstract/Free Full Text] - Rooney M, Varsani H, Martin K, Lombard PR, Dayer JM, Woo P. (2000) Tumour necrosis factor alpha and its soluble receptors in juvenile chronic arthritis. Rheumatology (Oxford) 39:4328.
- Lovell DJ, Giannini EH, Reiff A, et al. (2003) Long-term efficacy and safety of etanercept in children with polyarticular-course juvenile rheumatoid arthritis: interim results from an ongoing multicenter, open-label, extended-treatment trial. Arthritis Rheum 48:21826.[CrossRef][ISI][Medline]
- Lovell DJ, Giannini EH, Reiff A, et al. (2000) Etanercept in children with polyarticular juvenile rheumatoid arthritis. Pediatric Rheumatology Collaborative Study Group. N Engl J Med 342:7639.
[Abstract/Free Full Text] - Gregorio A, Gambini C, Gerloni V, et al. ( July 28, 2006) Lymphoid neogenesis in juvenile idiopathic arthritis correlates with ANA positivity and plasma cells infiltration. Rheumatology [Epub ahead of print].
- Moseman EA, Liang X, Dawson AJ, et al. (2004) Human plasmacytoid dendritic cells activated by CpG oligodeoxynucleotides induce the generation of CD4+CD25+ regulatory T cells. J Immunol 173:443342.
[Abstract/Free Full Text] - Ruprecht CR, Gattorno M, Ferlito F, et al. (2005) Coexpression of CD25 and CD27 identifies FoxP3+ regulatory T cells in inflamed synovia. J Exp Med 201:1793803.
[Abstract/Free Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




