Skip Navigation

Rheumatology 2009 48(1):45-48; doi:10.1093/rheumatology/ken417
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Noh, E.-M.
Right arrow Articles by Lee, Y.-R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Noh, E.-M.
Right arrow Articles by Lee, Y.-R.
Related Collections
Right arrow Immunogenetics
Right arrow Rheumatoid Arthritis
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2008. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org

Cordycepin inhibits IL-1β-induced MMP-1 and MMP-3 expression in rheumatoid arthritis synovial fibroblasts

E.-M. Noh1, J.-S. Kim1, H. Hur1, B.-H. Park1, E.-K. Song2, M.-K. Han2, K.-B. Kwon3, W.-H. Yoo4, I.-K. Shim5, S. J. Lee5, H. J. Youn6 and Y.-R. Lee1

1Department of Biochemistry, Institute for Medical Science, 2Department of Microbiology and Immunology, Chonbuk National University Medical School, Jeonju, 3Department of Physiology, School of Oriental Medicine, Wonkwang University, Chonbuk, 4Department of Internal Medicine, Chonbuk National University Hospital, Jeonju, 5Department of Pharmacy, College of Pharmacy, Ewha Womans University, Seoul and 6Department of Surgery, Chonbuk National University Hospital, Jeonju, South Korea.

Correspondence to: Y.-R. Lee, Department of Biochemistry, Institute for Medical Science, Chonbuk National University Medical School, Jeonju, Jeonbuk 561-180, South Korea. E-mail: mindyr{at}chonbuk.ac.kr


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Objective. MMP is a key enzyme in the degradation of extracellular matrices, and its expression plays important roles in inflammatory diseases. Cordycepin (3'-deoxyadenosine), a bioactive compound of Cordyceps militaris, has been shown to exhibit many pharmacological activities, such as anti-cancer, anti-inflammatory and anti-infection activities. In this study, we aimed at the inhibitory effect of cordycepin on IL-1β-induced MMP-1 and MMP-3 expression as well as the molecular basis using RA synovial fibroblasts (RASFs).

Methods. RASFs were isolated from synovial tissue obtained from 12 patients with RA and cultured in monolayer. Expression of MMP-1 and MMP-3 was evaluated using western blotting and real-time PCR. Chemokines were analysed by ELISA. The phosphorylation of mitogen-activated protein kinase was measured by western blotting. Electrophoretic mobility shift assay was performed to evaluate binding activities of DNA to nuclear factor-{kappa}B (NF-{kappa}B) and activator protein-1 (AP-1).

Results. Cordycepin inhibited IL-1β-induced MMP-1 and MMP-3 expressions in RASFs in a dose-dependent manner. Among various chemokines [such as monocyte chemoattractant protein-1 (MCP-1), GRO-{alpha}, regulated upon activation, normal T-cell expressed and presumably secreted (RANTES) and epithelial neutrophil activating peptide 78 (ENA-78)], cordycepin specifically blocked IL-1β-induced ENA-78 production in RASF. Moreover, cordycepin significantly inhibited IL-1β-induced p38/JNK and AP-1 activation, but not extracellular signal-regulated kinase (ERK) and NF-{kappa}B activation.

Conclusions. Cordycepin is a potent inhibitor of IL-1β-induced chemokine production and MMP expression and strongly blocks the p38/JNK/AP-1 signalling pathway in RASFs.

KEY WORDS: Cordycepin, Interleukin-1β, Matrix metalloproteinase, p38 mitogen-activated protein kinase, Activator protein-1


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Cordyceps militaris, a species of the fungal genus Cordyceps, is an ingredient of traditional Chinese medicine and has been prescribed for inflammatory diseases and cancer [1, 2]. Extract of Cordyceps exhibits anti-tumour effects on cancers and inhibitory effects on the production of inflammatory mediators [3, 4]. Cordycepin, which is a nucleoside derivative isolated from Cordyceps, has been reported to exert inhibitory effects on macrophages based on anti-inflammatory property [5].

RA is a chronic inflammatory disease that causes progressive joint destruction. It is characterized by synovial hyperplasia and joint destruction [6, 7]. The cartilage destruction observed in RA is mostly caused by the activation of MMPs [8]. MMP-1 and -3 have been shown to be the major enzymes produced by fibroblasts in the synovium [9]. MMP-1 preferentially degrades fibrillar collagens, whereas MMP-3 degrades a broad array of extracellular matrix substrates [10–12]. Pro-inflammatory cytokines such as IL-1β and TNF-{alpha} play critical roles in the pathogenesis of RA [13]. It is well known that cytokines stimulate production of MMPs through the activation of cellular signalling pathways involving mitogen-activated protein kinases (MAPKs), nuclear factor-{kappa}B (NF-{kappa}B) and activator protein-1 (AP-1) [14–16]. In response to cytokines, RA synovial fibroblasts (RASFs) produce chemokines, including β-chemokine regulated on activation normal T-cell expressed and secreted (RANTES/CCL5), epithelial neutrophil-activating peptide-78 (ENA-78/CXCL5), monocyte chemoattractant protein-1 (MCP-1/CCL2) and growth-regulated oncogene-{alpha} (GRO-{alpha}/CXCL1), which further promote inflammation and cartilage destruction by inducing MMP activity and expression [5, 17, 18].

In this study, we investigated the inhibitory effect of cordycepin on IL-1β-induced MMP-1 and -3 expression as well as the molecular basis in RA inflammation using RASFs.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Materials
Cordycepin was purchased from Sigma (St Louis, MO, USA). IL-1β, TNF-{alpha} and antibodies for MMP-1 and -3 were from R&D Systems (Minneapolis, MN, USA). High glucose-containing DMEM and fetal bovine serum (FBS) were obtained from Gibco-BRL (Gaithersburg, MD, USA). Antibodies for p38, p-p38, JNK, p-JNK, extracellular signal-regulated kinase (ERK) and p-ERK were purchased from Cell Signaling Technology (Beverly, MA, USA).

Isolation and culture of RASFs
RASFs were isolated from synovial tissue obtained from 12 patients with RA who met the revised ARA criteria [19], as described previously [20]. Cells were used at passages 4–8. All experiments were performed in serum-free medium throughout the study. Informed consent was obtained from all patients, and the study protocol was approved by the Chonbuk National University Hospital Ethical Committee.

Determination of cell viability
RASFs (2 x l04 cells/well) were treated with various concentrations of cordycepin. After incubation for 1 h, 12 h and 24 h, cells were washed twice with PBS, MTT (0.5 mg/ml PBS) was added to each well and incubated at 37°C for 30 min. Formazan crystals formed were dissolved by adding DMSO (100 µl/well) and the absorbance was read at 570 nm using a microplate reader (Model 3550, Bio-Rad, Richmond, CA, USA).

Western blot analysis
RASFs (5 x 106 cells) were pre-treated with cordycepin for 1 h and then incubated with IL-1β (5 ng/ml) or TNF-{alpha} (5 ng/ml) for 24 h. Cells were lysed with 40 µl of ice-cold lysis buffer (50 mM Tris–HCl pH 7.4, 1% NP-40, 0.5% sodium deoxycholate, 150 mM NaCl, 1 mM EGTA, 0.1% SDS). Samples were separated by SDS–PAGE with 10% polyacrylamide gels and electrotransferred into polyvinylidene fluoride (PVDF). The PVDF membranes were blotted with 1 µg/ml of primary antibodies for p38, p-p38, JNK, p-JNK, ERK, p-ERK, β-actin, MMP-1 and MMP-3. HRP-conjugated IgG was used as a secondary antibody. The protein expression levels were then determined by analysing the signals captured on the PVDF membranes using an image analyser (Las-1000, Fujifilm, Tokyo, Japan).

Quantitative real-time PCR assay
Total RNA was extracted from cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized from 1 µg total RNA using oligo-dT primers and AMV reverse transcriptase (Takara, Shiga, Japan). The expression of MMP-1 and -3 mRNA was determined by real-time RT–PCR using the ABI Prism 7900 sequence detection system (Applied Biosystems, Foster City, CA, USA) and SYBR Premix Ex Taq (Takara). The primers were: MMP-1 (NM 002424.2) sense, AGTGACTGGGAAACCAGATGCTGA; anti-sense, GCTCTTGGCAAATCTGGCCTGTAA and MMP-3 (NM 002422) sense, ATTCCATGGAGCCAGGCTTTC; anti-sense, CATTTGGGTCAAACTCCACTGTG and GAPDH (NM 002046) sense, ATGGAAATCCCATCACCATCTT; anti-sense, CGCCCCACTTGATTTTGG. To control variation in mRNA concentration, all results were normalized to the housekeeping gene, GAPDH. Relative quantitation was performed using comparative {Delta}{Delta}Ct method according to the manufacturer's instructions.

ELISA of chemokines
RASFs were pre-treated with cordycepin (50 µM and 100 µM) for 1 h and then incubated with IL-1β (5 ng/ml). After 24 h, culture medium was collected and centrifuged at 10 000 g for 5 min at 4°C to remove particulates. Quantities of RANTES, ENA-78, MCP-1 and GRO-{alpha} were determined using Quantikine ELISA kits (R&D Systems). Optical density was determined with Microplate reader (Model 3550, Bio-Rad). A standard curve of each cytokine was established using known concentrations of cytokine by plotting optical density vs log of the concentration.

Electrophoretic mobility shift assay
RASFs (5 x 106 cells) were treated with IL-1β (5 ng/ml) in the presence of cordycepin for 1 h. Cells were then washed with cold PBS. The activation of NF-{kappa}B and AP-1 was assayed by a gel mobility shift assay using nuclear extracts [21]. An oligonucleotide containing {kappa}-chain binding site ({kappa}B, 5'-CCGGTTAACAGAGGGGGCTTTCCGAG-3') and AP-1 (5'-CGCTTGATGAGTCAGCCGGAA-3') was synthesized and used as a probe. The two complementary strands were then annealed and labelled with [{alpha}-32P]dCTP. Labelled oligonucleotides (10 000 cpm), 10 µg of nuclear extracts, and binding buffer [10 mM Tris–HCl, pH 7.6, 500 mM KCl, 10 mM EDTA, 50% glycerol, 100 ng poly (dI·dC), 1 mM dithiothreitol] were then incubated for 30 min at room temperature in a final volume of 20 µl. The reaction mixtures were analysed by electrophoresis on 4% polyacrylamide gels in 0.5 x Tris–borate buffer, and the gels were then dried and examined by autoradiography. Specific binding was controlled by competition with a 50-fold excess of cold {kappa}B or cold AP-1 oligonucleotide.

Statistical analysis
Statistical analysis of the data was performed using ANOVA and Duncan's test. Differences with P < 0.05 were considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Effect of cordycepin on cell viability of RASFs
Cytotoxicity of cordycepin on RASFs has not yet been reported. Therefore, the effect of cordycepin on cellular toxicity of RASFs was assessed using MTT assay. Treatment of RASFs with cordycepin (50 µM or 100 µM) for 24 h did not cause any significant change in cell viability. However, cell viability was slightly decreased when cells were incubated with 100 µM cordycepin for 48 h (data not shown).

Effect of cordycepin on IL-1β-induced MMP-1 and -3 expression in RASFs
We performed western blot analysis and real-time PCR to investigate the effect of cordycepin on IL-1β or TNF-{alpha}-induced MMP-1 and -3 expressions. Western blot analysis revealed that treatment of RASFs with IL-1β or TNF-{alpha} increased the levels of MMP-1 and -3 (Fig. 1A). Pre-treatment with cordycepin for 1 h completely blocked the up-regulation of MMP-1 and -3 induced by IL-1β but slightly by TNF-{alpha} (Fig. 1A). Real-time PCR revealed that IL-1β increased the level of MMP-1 and -3 in RASFs and cordycepin blocked IL-1β-induced up-regulation of MMP-1 and -3 in a dose-dependent manner (Fig. 1B). Cordycepin itself had no effect on either MMP-1 or MMP-3 in RASFs (data not shown). These results indicate that cordycepin is a potent inhibitor of IL-1β-induced MMP-1 and -3 expression in RASFs.


Figure 1
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 1. Inhibition of IL-1β-stimulated expression of MMPs and cytokines by cordycepin in RASFs. RASFs in monolayer were pre-treated with the indicated concentrations of cordycepin for 1 h and stimulated with 5 ng/ml IL-1β and 5 ng/ml TNF-{alpha} for 24 h. The cell lysates were analysed by western blotting with anti-MMP-1 and anti-MMP-3. The blot was reprobed with anti-β-actin to confirm equal loading (A). RASFs were pre-treated with cordycepin for 1 h and stimulated by IL-1β for 24 h. Total cellular RNA was analysed by real-time PCR for MMP-1 and -3 (B). Level of MCP-1, GRO-{alpha}, RANTES and ENA-78 in culture media was measured using a Quantikine ELISA kit (C). Each value represents the mean ± the SEM of three independent experiments. *P < 0.01 vs untreated control; #P < 0.01 vs IL-1β.

 
Effect of cordycepin in IL-1β-induced chemokine production
To determinate the action of cordycepin in regulating the production of IL-1β-induced chemokines, we measured chemokine levels. As shown in Fig. 1C, IL-1β increased significantly the levels of MCP-1, RANTES, GRO-{alpha} and ENA-78 compared with vehicle. However, pre-treatment with cordycepin (100 µM) resulted in a significant inhibition of IL-1β-induced ENA-78 production, but not RANTES, MCP-1 and GRO-{alpha} production, indicating that cordycepin specifically blocks ENA-78 induction in IL-1β signalling.

Effects of cordycepin on the MAPK signalling pathway by IL-1β
The upstream regulatory regions of MMP genes contain the AP-1 recognition site. AP-1 can be activated by MAPK family [22, 23]. MAPK signalling pathway has been shown to be involved in IL-1β-induced MMP expression [24]. To investigate which MAPK is inhibited, the effect of cordycepin on IL-1β-induced activation of MAPK was elucidated by using western blotting. As shown in Fig. 2A, treatment with IL-1β significantly enhanced phosphorylation of p38, JNK and ERK. Pre-treatment with cordycepin blocked IL-1β-induced phosphorylation of p38 and JNK, but not ERK phosphorylation.


Figure 2
View larger version (63K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
FIG. 2. Cordycepin blocks IL-1β-mediated activation of JNK and p38 and IL-1β-induced AP-1 DNA binding activity in RASFs. Cells were pre-treated with cordycepin 1 h before IL-1β treatment. The cell lysates were analysed by western blotting employing specific anti-phospho-p38, anti-p38, anti-phospho-JNK, anti-JNK, anti-phospho-ERK and anti-ERK antibodies (A). Cells were incubated with cordycepin for 1 h, followed by stimulation with IL-1β for 24 h. The nuclear extracts were prepared and examined for NF-{kappa}B and AP-1 DNA binding activity by EMSA as described in Materials and methods (B).

 
Effect of cordycepin on IL-1β-induced NF-{kappa}B and AP-1 DNA binding activities
To clarify the mechanism of cordycepin-mediated inhibition of MMP-1 and -3 expression, the effect of cordycepin on IL-1β -induced activation of NF-{kappa}B and AP-1 was evaluated using electrophoretic mobility shift assay (EMSA). As shown in Fig. 2B, IL-1β increased substantially NF-{kappa}B and AP-1 binding activity. Pre-treatment with cordycepin inhibited IL-1β-stimulated AP-1 binding activity but not NF-{kappa}B binding activity. Cordycepin itself had no effect on NF-{kappa}B and AP-1 binding activities. These results suggest that cordycepin specifically blocks AP-1 activation in IL-1β signalling.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
In this study, we have for the first time provided evidence that cordycepin inhibits IL-1β-induced expression of MMP-1 and -3 and production of chemokines in cultured RASFs. Our results also showed that cordycepin blocked IL-1β-mediated activation of AP-1, but not NF-{kappa}B, and phosphorylation of p38 and JNK, but not other MAPK families.

MAPK pathway is involved in regulation of cell proliferation, apoptosis, cytokine expression and MMP production. Three major MAPK families, JNK, ERK and p38 kinase, are expressed and the active phosphorylated forms can be detected in synovial tissue and cultured RASFs [25, 26]. In the present study, our results suggest that cordycepin inhibits MAPK activation, specifically p38 and JNK activation, in IL-1β signalling. Supporting our observations, cordycepin inhibits the phosphorylation of p38 in macrophage cells [27]. Importantly, p38 plays a major role in the production of pro-inflammatory cytokines, including TNF and IL-1β [28]. Indeed, p38 inhibitors have been successfully tested in animal models of arthritis, such as CIA [28, 29]. A potent p38 inhibitor, SB 203580, blunts enhancement of secreted MMP-1 and -3 levels elicited by IL-1β [10]. These findings suggest that cordycepin inhibits IL-1β-induced MMP expression through inhibition of p38/JNK activation.

NF-{kappa}B and AP-1 have an important role in RA pathogenesis [30]. Cytokines induce the activation of AP-1 and NF-{kappa}B in RA [31, 32]. Cytokine-induced MMP expression is regulated by MAPK activation and transcriptional activation of AP-1 [33–35]. MMP induction by cytokines is different depending on type of MMPs and cells. In SW1353 chondrosarcoma cells and rabbit articular chondrocytes, IL-1β-dependent synthesis of MMP-13 requires p38, JNK and NF-{kappa}B, but MMP-1 induction depends on p38 and ERK but not JNK or NF-{kappa}B [36]. In SFs, AP-1 is an essential component for MMP-1 synthesis, and cooperation between MAPK and NF-{kappa}B signalling pathways is necessary for IL-1β-dependent synthesis of MMP-1 [37, 38]. Our results show that cordycepin inhibited MMP-1 and -3 production by suppression of AP-1, but not NF-{kappa}B in RASFs.

Production of chemokines, such as MCP-1, GRO-{alpha}, RANTES and ENA-78 in synoviocytes has been shown to induce proliferation of the cells and to facilitate their invasion into the adjacent tissues [39]. Chemokines play a role in the breakdown of cartilage by inducing the release of MMPs [39–41]. In this study, we found that IL-1β increased production of several chemokines in RASF. ENA-78 plays a critical role in the recruitment of inflammatory leucocytes into the joints of RA patients [42]. Moreover, ENA-78 also plays an important role in progression and maintenance of RA [43–45]. Our results showed that production of ENA-78 was enhanced by IL-1β and cordycepin specifically suppressed the production of ENA-78 in a dose-dependent manner, indicating that cordycepin is an inhibitor of ENA-78-mediated pathogenesis.

In conclusion, our results have demonstrated that cordycepin is a potent inhibitor of IL-1β-induced chemokine production and MMP expression and strongly blocks the ability of AP-1 and p38/JNK signalling pathway in RASF. Cordycepin in combination with pentostatin is under a Phase I clinical trial on chronic myelogenous leukaemia. In dogs, 8 mg/kg/day is the absolute limit for short-term treatment [46]. The dose of cordycepin that can inhibit IL-1β-induced chemokine production and MMP expressions is below the toxicity limit. Thus, cordycepin may be a potential candidate to prevent inflammation of RA.

Formula


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 
Funding: This work was supported by grants of the Korea Science and Engineering Foundation (M10528010003-05N2801-00310).

Disclosure statement: The authors have declared no conflicts of interest.


    Notes
 
E.-M. Noh and J.-S. Kim equally contributed to this work.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Acknowledgements
 References
 

  1. Cunningham KG, Hutchinson SA, Manson W, Spring FS. Cordycepin, a metabolic product from culture of Cordyceps militaris (Linn) Link. Part I. Isolation and characterization. J Chem Soc (1951) 2:2299–302.
  2. Ng TB, Wang HX. Pharmacological actions of Cordyceps, a prized folk medicine. J Pharm Pharmacol (2005) 57:1509–19.[Medline]
  3. Hubbell HR, Requignot EC, Willis DH, Lee C, Suhadolnik RJ. Differential antiproliferactive actions of 2',5' oligo a trimer core and its cordycepin analogue on human tumor cells. Int J Cancer (1985) 36:389–94.[Medline]
  4. Won SY, Park EH. Anti-inflammatory and related pharmacological activities of cultured mycelia and fruiting bodies of Cordyceps militaris. J Ethnopharmacol (2005) 96:555–61.[CrossRef][Web of Science][Medline]
  5. Jeong JG, Kim JM, Cho H, Hahn W, Yu SS, Kim S. Effects of IL-1β on gene expression in human rheumatoid synovial fibroblasts. Biochem Biophys Res Commun (2004) 324:3–7.[CrossRef][Web of Science][Medline]
  6. Pap T, Muller-Ladner U, Gay RE, Gay S. Fibroblast biology. Role of synovial fibroblasts in the pathogenesis of rheumatoid arthritis. Arthritis Res (2000) 2:361–7.[CrossRef][Web of Science][Medline]
  7. Yoshihara Y, Nakamura H, Obata K, et al. Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis or osteoarthritis. Ann Rheum Dis (2000) 59:455–61.[Abstract/Free Full Text]
  8. Feldmann M, Brennan FM, Maini RN. Role of cytokines in rheumatoid arthritis. Annu Rev Immunol (1996) 14:397–440.[CrossRef][Web of Science][Medline]
  9. Konttinen YT, Ainola M, Valleala H, et al. Analysis of 16 different matrix metalloproteinases (MMP-1 to MMP-20) in the synovial membrane: different profiles in trauma and rheumatoid arthritis. Ann Rheum Dis (1999) 58:691–7.[Abstract/Free Full Text]
  10. Ogata Y, Enghild JJ, Nagase H. Matrix metalloproteinase 3 (stromelysin) activates the precursor for the human matrix metalloproteinase 9. J Biol Chem (1992) 267:3581–4.[Abstract/Free Full Text]
  11. Knauper V, Lopez-Otin C, Smith B, Knight G, Murphy G. Biochemical characterization of human collagenase-3. J Biol Chem (1996) 271:1544–50.[Abstract/Free Full Text]
  12. Jackson C, Nguyen M, Arkell J, Sambrook P. Selective matrix metalloproteinase (MMP) inhibition in rheumatoid arthritis–targetting gelatinase A activation. Inflamm Res (2001) 50:183–6.[CrossRef][Medline]
  13. Dayer JM, Feige U, Edwards CK 3rd, Burger D. Anti-interleukin-1 therapy in rheumatic diseases. Curr Opin Rheumatol (2001) 13:170–6.[CrossRef][Medline]
  14. Feng X. Regulatory roles and molecular signaling of TNF family members in osteoclasts. Gene (2005) 350:1–13.[CrossRef][Medline]
  15. Kyriakis JM, Avruch J. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol Rev (2001) 81:807–69.[Abstract/Free Full Text]
  16. Engsig MTCQ, Vu TH, Pedersen AC, et al. Matrix metalloproteinase 9 and vascular endothelial growth factor are essential for osteoclast recruitment into developing long bones. J Cell Biol (2000) 151:879–89.[Abstract/Free Full Text]
  17. Yamanishi Y, Firestein GS. Pathogenesis of rheumatoid arthritis: the role of synoviocytes. Rheum Dis Clin North Am (2001) 27:355–71.[CrossRef][Medline]
  18. Abeles AM, Pillinger MH. The role of the synovial fibroblast in rheumatoid arthritis: cartilage destruction and the regulation of matrix metalloproteinases. Bull NYU Hosp Joint Dis (2006) 64:20–4.
  19. Arnett FC, Edworthy SM, Bloch DA, et al. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum (1988) 31:315–24.[Web of Science][Medline]
  20. Lee YR, Lee JH, Noh EM, et al. Guggulsterone blocks IL-1β-mediated inflammatory responses by suppressing NF-{kappa}B activation in fibroblast-like synoviocytes. Life Sci (2008) 82:1203–9.
  21. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem (1976) 72:248–54.[CrossRef][Web of Science][Medline]
  22. Karin M, Liu Z, Zandi E. AP-1 function and regulation. Curr Opin Cell Biol (1997) 9:240–6.[CrossRef][Web of Science][Medline]
  23. Crawford HC, Matrisian LM. Mechanisms controlling the transcription of matrix metalloproteinase genes in normal and neoplastic cells. Enzyme Protein (1996) 49:20–37.[Web of Science][Medline]
  24. Kim HG, Shrestha B, Lim SY, et al. Cordycepin inhibits lipopolysaccharide-induced inflammation by the suppression of NF-{kappa}B through Akt and p38 inhibition in Raw 264.7 macrophage cells. Eur J Pharmacol (2006) 545:192–9.[CrossRef][Web of Science][Medline]
  25. Schett G, Tohidast-Akrad M, Smolen JS, et al. Activation, differential localization, and regulation of the stress-activated protein kinases, extracellular signal-regulated kinase, c-jun N-terminal kinase, and p38 mitogen-activated protein kinase, in synovial tissue and cells in rheumatoid arthritis. Arthritis Rheum (2000) 43:2501–12.[CrossRef][Web of Science][Medline]
  26. Sweeney SE, Firestein GS. Signal transduction in rheumatoid arthritis. Curr Opin Rheumatol (2004) 16:231–7.[CrossRef][Web of Science][Medline]
  27. Kumar S, Votta BJ, Rieman DJ, Badger AM, Gowen M, Lee JC. IL-1- and TNF-induced bone resorption is mediated by p38 mitogen activated protein kinase. J Cell Physiol (2001) 187:294–303.[CrossRef][Web of Science][Medline]
  28. Patten C, Bush K, Rioja I, et al. Characterization of pristane-induced arthritis, a murine model of chronic disease: response to antirheumatic agents, expression of joint cytokines, and immunopathology. Arthritis Rheum (2004) 50:3334–45.[CrossRef][Web of Science][Medline]
  29. Wadsworth SA, Cavender DE, Beers SA, et al. RWJ 67657, a potent, orally active inhibitor of p38 mitogen-activated protein kinase. J Pharmacol Exp Ther (1999) 291:680–7.[Abstract/Free Full Text]
  30. Liacini A, Sylvester J, Li WQ, Zafarullah M. Inhibition of interleukin-1-stimulated MAP kinases, activating protein-1 (AP-1) and nuclear factor kappa b (NF-{kappa}B) transcription factors down-regulates matrix metalloproteinase gene expression in articular chondrocytes. Matrix Biol (2002) 21:251–62.[CrossRef][Web of Science][Medline]
  31. Morel J, Berenbaum F. Signal transduction pathways: new targets for treating rheumatoid arthritis. Joint Bone Spine (2004) 71:503–10.[CrossRef][Web of Science][Medline]
  32. Rannou F, Francois M, Corvol MT, Berenbaum F. Cartilage breakdown in rheumatoid arthritis. Joint Bone Spine (2006) 73:29–36.[CrossRef][Medline]
  33. Francois M, Richette P, Tsagris L, et al. Peroxisome proliferator-activated receptor-gamma down-regulates chondrocyte matrix metalloproteinase-1 via a novel composite element. J Biol Chem (2004) 279:28411–8.[Abstract/Free Full Text]
  34. Sylvester J, Liacini A, Li WQ, Zafarullah M. Interleukin-17 signal transduction pathways implicated in inducing matrix metalloproteinase-3, -13 and aggrecanase-1 genes in articular chondrocytes. Cell Signal (2004) 16:469–76.[CrossRef][Medline]
  35. Migita K, Miyashita T, Maeda Y, et al. FK506 suppresses the stimulation of matrix metalloproteinase 13 synthesis by interleukin-1β in rheumatoid synovial fibroblasts. Immunol Lett (2005) 98:194–9.[CrossRef][Web of Science][Medline]
  36. Mengshol JA, Vincenti MP, Coon CI, Barchowsky A, Brinckerhoff CE. Interleukin-1 induction of collagenase 3 (matrix metalloproteinase 13) gene expression in chondrocytes requires p38, c-jun N-terminal kinase, and nuclear factor {kappa}B: differential regulation of collagenase 1 and collagenase 3. Arthritis Rheum (2000) 43:801–11.[CrossRef][Web of Science][Medline]
  37. Lu HT, Liang YC, Sheu MT, et al. Disease-modifying effects of glucosamine HCl involving regulation of metalloproteinases and chemokines activated by interleukin-1β in human primary synovial fibroblasts. J Cell Biochem (2008) 104:38–50.[Medline]
  38. Barchowsky A, Frleta D, Vincenti MP. Integration of the NF-{kappa}B and mitogen-activated protein kinase/AP-1 pathways at the collagenase-1 promoter: divergence of IL-1 and TNF-dependent signal transduction in rabbit primary synovial fibroblasts. Cytokine (2000) 12:1469–79.[CrossRef][Web of Science][Medline]
  39. Garcia-Vicuna R, Gomez-Gaviro MV, Dominguez-Luis MJ, et al. CC and CXC chemokine receptors mediate migration, proliferation, and matrix metalloproteinase production by fibroblast-like synoviocytes from rheumatoid arthritis patients. Arthritis Rheum (2004) 50:3866–77.[CrossRef][Web of Science][Medline]
  40. Borzi RM, Mazzetti I, Cattini L, Uguccioni M, Baggiolini M, Facchini A. Human chondrocytes express functional chemokine receptors and release matrix-degrading enzymes in response to C-X-C and C-C chemokines. Arthritis Rheum (2000) 43:1734–41.[CrossRef][Medline]
  41. Kanbe K, Takagishi K, Chen Q. Stimulation of matrix metalloprotease 3 release from human chondrocytes by the interaction of stromal cell-derived factor 1 and CXC chemokine receptor 4. Arthritis Rheum (2002) 46:130–7.[CrossRef][Medline]
  42. Koch AE, Kunkel SL, Harlow LA, et al. Epithelial neutrophil activating peptide-78: a novel chemotactic cytokine for neutrophils in arthritis. J Clin Invest (1994) 94:1012–8.[Web of Science][Medline]
  43. Walz A, Schmutz P, Mueller C, Schnyder-Candrian S. Regulation and function of the CXC chemokine ENA-78 in monocytes and its role in disease. J Leukoc Biol (1997) 62:604–11.[Abstract]
  44. Halloran MM, Woods JM, Strieter RM, et al. The role of an epithelial neutrophil-activating peptide-78-like protein in rat adjuvant-induced arthritis. J Immunol (1999) 162:7492–500.[Abstract/Free Full Text]
  45. Koch AE, Volin MV, Woods JM, et al. Regulation of angiogenesis by the C-X-C chemokines interleukin-8 and epithelial neutrophil activating peptide 78 in the rheumatoid joint. Arthritis Rheum (2001) 44:31–40.[CrossRef][Web of Science][Medline]
  46. Rodman LE, Farnell DR, Coyne JM, et al. Toxicity of cordycepin in combination with the adenosine deaminase inhibitor 2'-deoxycoformycin in beagle dogs. Toxicol Appl Pharmacol (1997) 147:39–45.[CrossRef][Medline]
Submitted 6 May 2008; revised version accepted 29 September 2008.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Noh, E.-M.
Right arrow Articles by Lee, Y.-R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Noh, E.-M.
Right arrow Articles by Lee, Y.-R.
Related Collections
Right arrow Immunogenetics
Right arrow Rheumatoid Arthritis
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?